%PDF-1.3 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream application/pdf PERSONAGENS infografico impressos Adobe Illustrator CC 22.0 (Macintosh) 2020-11-13T14:59:28-03:00 2020-11-13T14:59:28-03:00 2020-11-13T14:59:28-03:00 256 248 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgA+AEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8AV8w3NwPMGpgSuALueg5H /fjZ2mCI4I+4PC6mZ8SW/wDEfvS/61c/79f/AII5bwhp45d7vrVz/v1/+COPCF45d7vrVz/v1/8A gjjwheOXeqWzX1zcRW8MjtLM6xxryO7MaAffkZ8MQSejOHFKQAPNFT6fq0Ed1JLLRLSQRSn1ertu oTf4qgE7dspjmgSAB9TdLT5Igkn6fNfFpWsSQrMs37tk9QkyH4Vpy3+jwyMtTjBqmyOjyyAIPPzd HpmryMVWb4wqsy+oaguKhT/lU6+HfAdVj7kjRZe/7W10nWjLbRtIU+tQi4Rmk2EZIALb1qea0Xqa jJHUY9/IsRpcu2/MXzWWenaveCT6vLzMZZeIl3bgKtx3+Kg327ZLJmhA0QwxYMkxYPXvUL2HUrOS JJJS3rgGF45OSsDIY9mBp9tSMMMsJAmuSJ4ckZCJPPzR1xoOuW8s0cky0t3KTuJqhCA5HLuOQibj tv8ATlQ1WPu+xuOjy9/2oWe01SC1F00pMVUVuMlSpkDFOS1qOQQkZZjzQkaAasuDJCNk/aqtpWsr NHD6lZJG4gCToePOh/2OQGpxkE1ybDo8oIF8/P4rIrDVJI3kWf4VKqpMhHIs5jHHx+JcfzELql/K ZKviHz86VZdI1mKAztMDFxZ0ZZeQZUJVipBPQqRviNTjJqllo8oF39qlf6frFjJLHcuytAEMgEla ep0Gx61FD4ZPHmhKqHP9DXkwZIXZ5V170D9auf8Afr/8Ecv4Q43HLvd9auf9+v8A8EceELxy73fW rn/fr/8ABHHhC8cu931q5/36/wDwRx4QvHLvegfkjeEeb545pjWWykWJWY/E4kjagr34qTmq7Xj+ 6H9b9Bdx2JInMbP8P6Q90zm3qHYq7FXYq7FXYq7FXYq7FXYq+OPOPmtLTzfrlobYubfULqIvzpXh My1pT2zqcOrqA26B5LPoSZyN9Sllt5te6uYra3sHluJ3WOGJGqzO54qoHHcknLPzg7mr+Tz3pysP m1ru3tV8u3Re7cR2soNYJWKGQenPT0WHBS3IPSgr0wfnh3Mv5Ol3rG/xWgmaTy3exxW4laed0ZIk WAEyEysgSi8T3x/PDuX+Tj3q1ncedrW6iuYPK2piaEiRD9WmNCOhoYjkMmqjKNH72eLRShISB5eS Lj1zzxcPfWqeVrv12tohcRehJG6wLSOMiPgvUw0Hwn7Jp3ykZIAg77ebkSx5JAjbfy/a1aeYvPEv pWY8uX8sdq31URSRyKkbXCx/A7lF9PkDG1Cw6174JSgST3+f7GUI5AANthXI/rV11z8xBbSlPLGo onD6vcAQy1cSxlW5IYyWBRd9qA0PUjI3jv8Ab+xl+9rp8j+toa959jv7YSeV7p7m1ie4hgMLKzRs kELECNEZyimNWA3Wu4w8WOuu/mjhyX028v2rItZ8+W00yp5YvDLPI7NMkUjKrSArIFdF4DaqsO24 2ocnPLCRF93ewx4skAQCNzfL9qjfal5zfU7OK48rXSPHI1raw+k/ovJWSRlVipV/i5yVDU2r0GMc sBEgXv5olhmZiRrby/aiZPNvnu5uLkf4WvJJGn/01YoJm5ScGZUYqhpxSfktD0IPhkLx+fzbKy+X y/asuNR8+Xtm0Z8r3ZikCXMkqRNVwARGK8eoEpog+Lfpk8eWEDY+9rzYcmSNEj5ftWw+YvOM0Vpf p5auDBdSwrbXLCRQztSJCGNFCy+si8iKE04mtchcOW/4+DbWQ77fI/raXUfPRkjsI/K98jNLyiT0 pOIIcH7bJTirNuS23fJDJC78u/yruYHFkqtud8vO+9oecfOl5bG1tvL949o0KSejbwu8ZheUypLt G4KvIrFX+YBpXI3C73v3/sZVk5bfI/rXXmveertZFuPKV85lXjy+qzqQTK0vIcEQVLSnqD1yUJwi QR082M8c5Ag1v5ftSuGTzVPDFPD5Y1GWGZQ8MqQTMrqw5KysI6EEbimZP50d32uF/Jx7/sVfR85e i83+FtR4RsEcelJyBILV4cOVKDrSmP56Pd9qf5Ol3/Yo6jceZdNga4v/AC7e21vGqNJPIjrGok48 eT8OKmrgUJrXbriNaD0Qezj3/YlH+No/+WQ/8GP+acl+b8kfkD3vQfyJ8xJqX5jWUAgMRWG4fkW5 dIiKdB45gdo5+PFVdXZdl6Xw8t30fT2aB6B2KuxV2KuxV2KuxV2KuxV2KvE9d/IvyZqWt6hqNxNe i4vbma4mCSxhQ8shduIMZ2q2bWGUiIdROA4ig4fyB8lwTJNDdajFNEweORJ0VlZTUMpEdQQcn4pY 8ATO5/LPT2aM3HmLXpGjYvFyvmYqxQxlhVNiUdl+RIwCR7gkhS/5VnpH1aS1/wAQa4bab1DNAb0m N/WYtLzQpxbmzktXrU1w2e4IoIu78kw3c7TzeZtdDvQlYrsRJ8IAFI440QdOw98FnuCUOv5c6cs7 3C+Y9fE8iqkkovmDskZYopbhUhS7UHucNnuCKC1/y10h42jbX9bKvMLmQ/W/ieZPT4SO3p8mZPQT jU/DxFMbPctBWXyFar6lPM2vkyKEYm+JNFYMKEoSpqOo/icbPcF2Uz+XOnNcJcHzHr5uI0aNJjfN zVHKllDcKgMUUkewxs9wWgvtvy+sLaKSKDzFrixyli6/XKjk8nqs4rGeLmT4iw3rXfc42e4Ls0fy zsJzFK3mPXna2YvC7X7ExsUKFlqnwng7Lt2JwcR7k05Py80+MOI/MeuxmSQyyul4Vd3ZETk7hAzf DEoHI7Uw2e4I2WQflxptvBHbweY9eigiRY4okvmVFRRRVVQlAANgMbPcFoLB+WWkC1itB5g10WsH p+hAL0+mnokNFxXhQcGRStOlBTGz3BaC/wD5VxpvrJP/AIj171o0aOOX683JUcqWUHhUBvTWo9h4 Y2e4LQWW/wCWWj2xU2/mDXISsUcC+nelaRQ8vTjFE+ynNuI6Cpxs9wWgrN+X1kxBbzN5gJHQm/fw I/l98bPcF2Wwflzp1vDHBb+Y9fighQRwxJfMqoigBVUBKAADpjZ7gtBWm8jQSyvK3mfXw0jFmCXx Rak1+FVQKo9gKYLPcFQ9x+VWk6jZtZXWva3dWZ4h7aa9LxniQVqjIRsRtjxkdE8IKXf9C9+Rf9/X /wDyOj/6pYfFKPDDJ/y6/KHyt5a8xrq2nyXbXUUMiKJpEZKPRTUKinofHMfU5CY05OlgBL4PU817 sHYq7FXYq7FXYq7FXYq7FXYqxa5/3ol/12/XmxhyDq58yp5JikfmvVH0rTZ7+O0mv5IEBS0tlLyy MzBQAB2q1WPYVOWQDCTGj+YtmAqnR9V+sm0+vfUxbr64j+s/VuPplw3Pl8dP5N8s4WNse1Wa38w6 1p921n5l0i7ukW1E1nEsKxRieRVM8m7pXlzcA0pTrSuHkqRvLqAtQZ187Jd8SywxSl4ySOSBpAoI rUVou3vh+SEfbRxXVgZb2PzdLJp9hJbTJKnE3IuXKOVQu5dgZg1C1OMYrXjuFU7h4ryTUC1n5sht WmGpR8V4yRXBlcGK1ipxVf8ASC9Q/wCzv03VT/SdfvtEt9Z06DTdd1efT5HlgudR5P8AWArxQlYZ grGlSXRQpqoJ70AISEcnnvWDf29u/lm+W3lNuJLkK7CP11VmYr6YJVCxBPXbcLjSbZzB/cTfL+uV nmyDD/OtpqU1xpDWWrTaWzXBtwYUMivJJR0Mi+pGpVRCwowYfF0yYYsLsfN1zPq7G28+LdW7W90Z kfTnjMawW8sqSKvpFGMZq7048goG+wyVeTG1KXzvemw0+8HnpoLaflBJMdLjdjcR1ll5xhPgVI5Y U+FmqxPvjXkt+apH5ymUXFvf+e+M80UElmo0tleIsYbhXf00oapyQpyIo30Y15LaK07zPLq1hbyW fnWSHUnmt9PeSTTwVaaeW5MY9GjRK0ihRyB2CfF9rGvJbS5fPESTPJP59kvIbmKS2eOHTHh9LlHI Enr8BHpO4YlPiNAOnQ15LaKj8xan+lBbP+YDGZLYXtP0UixtbtD9bbYL9oQIH3FQDQb1GCvJb803 8taxcaz5wjmt/M8t5YulxexaV9T9BPqqyPbxAyVUmjyVBK1biK02wEbJD02x6v8ARlUmcUXkGSY6 H/vW/wDxjP8AxIZRqPpcjTfV8E8zDc52KuxV2KuxV2KuxV2KuxV2KsWuf96Jf9dv15sYcg6ufMqe SYoO9H7xT7ZZFjJjXmbR/MWotZnRtaOj/V2dpqQJP6pYBUqHIFF+LbcGtewyYLEoOTRPPT3OqMvm VIoLgn9GRizhc26mRHBYmnMhA8dDXry67Y2EUUPc+V/PbtbzQebTDcRwGG4b6nE0creq7h/SLcFY IypUCvw++GwtFu48v/mHNd3E0XmtLS3klla3tVsYJRHEXb0l9RgrMQlK17+ONhaKIsNB87wyI155 o+tKJ4ZGQWMEYaBC3qxbVNZKr8Vfhp74LC0lieS/P6RRRL50k4QsHjraIzVFftuzl3FT9liR+GGx 3LRZpYxXMVlbxXU/1m6jjRZ7niE9SRVAZ+C7LyO9B0yKUdAD6Ex9siebIIeg+7pkmK304x0UfcMV d6cdKcRT5DFWBWv5ceYU5xXnmSW9tnltpWWdHckQszSR8WlK8XqOtflsDkuJFIiy8kecrK2mSDzd K1xLKj+vPbLPxRA/JFSV5FXkWBqtOlN9qNhaZJ5f0m507SILO+uzqN1Fz9S8dSGfk7MKgs5+EMF6 9sBKUy9NOvEeHT6MCuCIpqFAPsMVRdj1f6MhJlFF5BkmOh/71v8A8Yz/AMSGUaj6XI031fBPMw3O dirsVdirsVdirsVdirsVdirFrn/eiX/Xb9ebGHIOrnzKnkmKGu5XVgq06V6V/Xk4hiSwGHzX+Z6S ss/lWKZEqOcd1DGHNBQryMlBUN18R0oa2cIY2UVYea/PbRXj6j5Y+rrbW89xCUuYpGldKtFbrHGs jc2FBy6d6dFwcIWystvOPn2S69C48oGBTFNKsgvYXUtElUQkR0Bkcqoqe9exw8IWyhoPPX5iTmTj 5IdfTdo253sKVK9ePOJeQ8GGx8ceAd6OIohfNn5iLptvK/lIS3zO6XECXluiqqLGVkBIfaRmcca1 HHrvjwhNlXj82edXu5If8LsIo4eZnN1CAZ/qwm9FQUHIeqwi5jatT2pg4QtldYeaPObX9tb3/low WkixC4v4riGQJI6Dl+5A5cVkPEnl03x4Qtll8MzGFyQCVG2QI3ZAsFsvzHuJ7iG2m8tatFNNIkYZ bUNCpcLXnJJ6XEIzEMadq5ZwsbRS+eZTfalaHQNTP1BiI5ltgUuAsiRExFioNWcsN/sDl7Y8K2lY /NG8E0av5T1j0io9V1tasr0PIKpChlBpRiw+W27wI4kbb/mI0q3bN5d1eNbaMSoDZjlKpeOPio5f b5SE8a/ZUmvbHhTanc/mhaQS20P6D1eW5uYDci3js0aVIxK8P7xOYZfijr8iPHHgRxK7/mFwtpp2 8vazWGSKMwiyUyN6yu4ZAH3VfToxrsSPHHhTanbfmTFM7q/l/WbZI4pZmmnslSMLDE0pHLmd2CcV /wAogY8K8Sy1/M+1uVuWi0LVybaFLjj9TQtIkkgjT0gHPLlUsO1FY9seBeJlHlLzANbspbkWF3p4 jkMfo30IglNFDcgoLVX4qV8QcrmKZRKeZBkmOh/71v8A8Yz/AMSGUaj6XI031fBPMw3OdirsVdir sVdirsVdirsVdirFrn/eiX/Xb9ebGHIOrnzKnkmLHvOGuNo1ol0lhdajI7emlvZx+o3IqzBnp9lP hoWoaV6ZZAMJPLNY1OTUtcn1FbPzlYw3EaKyWamLi0fwqqxAEcKcmqZPtE/DvXLQPcwVrmw9XVtV FlJ5r02X1bq7kEaBbN5F5SOIxG6+pz48Y6NvtviqH0+e1sreK1Sy84y2aXMN1wliU0e3dnWMINvT kaQs/uq4/JVLW4NPitlsLlvN84l4XAd+PGeW4hidIZHatXTiE4haq3Ib4R8FREc99Bf2Otqnmz6n JcMZNDUOViMPCXjQsA1ufUESqyioDb7UIVu9cwXf1eVPORuLEyWj3lp8a3McVxM0cjzfuy9RL8O1 ANh4l+Spxo09t5dmv75T5l1WWOc2c9lcJ65ckVW7RPg5IRBwWSte1OmA7pejaVdC70xboRSQC4iS X0Zl4SpzXlxdd+LLWhHjlcubMcnjeo2uo/X7yxt7zzjG9tJIiXvJ5YHSBCSyAGMuZGUqgDb1Br+z l3ya2tUuVvImjt7Tzja+pdTXR4xEIjzESJxj5fEsUyBlHJTuTyrTH5KidPtJdSt7K0nl83RNb3Ua pfyVilMt4vpuzcufGCIQ1rzJXmR3wK3e6s5tLmGK386GV0tzG6rwo1vCYwA4LEety5Smhq2/bGvc qhp+q3kEwcWfm9Ijb/VGt+JeNI/qwi9SIEJSVZaFW/2W1aA0qJ1W1szZXmmXk/m2SHTpXLTkqRdG WaC2SON22lHOjxg+LHAFW620xt7iwij823DaajwvL6jRrd/6SQaMFk9Tksx+Lj9hAMQqrOLhAuip N5vb/TWEuoV3NCsdRcVPGBQWYDh8R69Bj8lehfl0ZT5bt2l+vByZdtVYteUEzhfVJCncCo9qZVkZ xZRlbNMdD/3rf/jGf+JDKNR9Lkab6vgnmYbnOxV2KuxV2KuxV2KuxV2KuxVi1z/vRL/rt+vNjDkH Vz5lTyTFIfM3lttYkhY3t3bRxw3MDw20nBJBcx+nykUg8mj+1H4HLISpjIMf038tprCa1ePXtZkj tXjZLeS6rEyxEUjZOIHAgUI8MlxhjwoVvypunciXzPrskI4MiNdkkSIxbkSQQd+JX4diK/I8YXhR L/lvc+itvBr+sW1qqQIIobgIR9Wi9JeDBfhDglpAPtNQ9seMLwqg/Llhrw1r9Maqbj1RIYvrA9Ix iT1fq5ULX0a/sV6YOMLwqEf5XsmnXFh+ndZaK5lWaRjdDlsJOaghfsymYmT+YgYeMLwqWsflHYar bvHdX9+8rT3FykrujlXuFjUrQruirCAq+53xE14UWPy3WOzura31bVLY3l4b6WeCdY5eRUqYwyoP gNensMHGvCyLyx5ej0PQo9Khlklji58JJyDIebs55FQo6v4ZCUrLIBE+i/iv/BDJWikj1zQfMt3d mfS9bGmr9WMEcRhjmVZWmRzNRmAY8E4AMDSpIwiQRSX2nlj8wYpGa482pcIYpUCfUbZKSPGyxyVU /sOQ1O9KY8Q7lorI/Kf5gR6fb2yebl9eF3Mly9nA7PEVjEaHkx3Qo55VqeW/TDxDuWi4eUvPg0+4 tf8AFoM00oeO4NrDyRCJPUQfHX4mkUqQRx40Wgx4h3LRdaeVPzAgtpoX83LKxhWO2kazgLRurofU JLEyVjVl+I/tV6jHiHctFbe+UfP09zFPD5u+r+jGqKgtISpf01WV3XkFbmylgCPhrtjxDuWizH0X 8V/4IZG00ibSJkDEkb7bGuQkWQCIyKUx0P8A3rf/AIxn/iQyjUfS5Gm+r4J5mG5zsVdirsVdirsV dirsVdirsVYtc/70S/67frzYw5B1c+ZU8kxSbXrfzTJcW8uh3dvbxww3DTQXMfNJ5yqi2RitHRA3 IsytXpsckK6oLHBefm+qiSWTy0sJkWL1OV5Tm0gi41Lfa5/CB/NtkvT5o3RIuvzIeHU7CW60KPWz CsmkRQmfl6Zk4STzJIXYBV+zRSOXX3HpXdDvcfnLH6aSf4bWSVuEQZrwFyFLcV33bipbbsMPp813 ROjz/mbNZabJLNod2hnYX9zC07B7VfTAaErRPVLery24/ZoOuA8Ki0PZ6j+bRt2u7qLQWtmimNsI Hn5SylGFpwZn9PjLL6fVh8J7HDUfNd1GfVPzUkurC2sZ/L01yySS3sKPNtweWKvEuzmIEICyiok2 6VxqPmu7cH/K8YpGR/0DcLIzyCR/rAWMVXjEOHBqbmlQTsat0x9PmvqZrbG+/RcJv/TF/wCiv1v0 OXperxHqeny+LjyrxrvTIjmnoxnzHqnmSwktTo+jjV4pBILpfXS3aMjh6ZDPUEH4tqfSO9oYFIoP Nnn1rU3cnl+B1mniWwtI7uHlLFJHM7FZubIzJwQ7LuK/MGgjdGT+avNUdvZqnlxJdUuFlkudMGoQ CWCJGCo5JUcxJv8AZ2HjXBQW1HUfM/n611C6MXlZJ9LgLrFMb2GJnVGNJizbKjIK8StR44aC2UTc eYvPEZufS8qCb0ZxFARfxL60Z51mWsfwgcF2bf4vY4KC2VCLzH+YMlrfM/lRYbhIudihvIXDSFkT g9KVoGeStRsOPXfDQWyvXzV5uNxb2reWOFxLayXMyNexDg6NKqxKeBEhb046lfs+ovKnXGgtt6N5 v8wXN/6Gr6ANHt+LlriW9hcgxlv91FY24kRuwYbUFemJCgsz0qeG4i9aCRZYJFV45EIZWU7gqRsQ cqmzijsgyTHQ/wDet/8AjGf+JDKNR9Lkab6vgnmYbnOxV2KuxV2KuxV2KuxV2KuxVi1z/vRL/rt+ vNjDkHVz5lTyTFKvMfljRPMdiljrFv8AWbWOQTLGHeP41VlBqhU9HOSEiOSCLSGf8nvy9nWFZdML Lbp6cQ9e4FF5tJTaTf4nY74fEKOEMavvIFpdavqN1c+SDcfWLq/kSddSaMuqRCSFyvqEA3c1VAAH pjr7yEvNHD5JS3lDU7i3tIb38tvVWztxbQhNYMYUGR5n/bf4WklJAJJHidqS4vNFeSro3k0zyXvq /l2YLC7tnRC+oustYgZhGRIwYGWeFFDBVoCSeSk1Bl5rXkjrTyNbQ61p6p5AaO2SS2ma/wD0ry9C SVY3mPpE1f0HqP8AK41HXHi25pryTHyn5FttR0uTTvMvlf8ARcVtbpawCO+kljmje4e6cKqyM0fG UKSS5JrStBglLuKgJl/ypX8ttx+ijQmpH1i5/wCqmDxJJ4Ay6CytrHTIrK2XhbWsKwwJUtxSNQqi rEk0A75Ec09GBzflJ5Iub27vby0kubm8nkuZHeaRaNK3JlURlBxBJpXf3y7iLXwhjd55Xlh1ad7b yC9ykavZQ3f6W4epbLEbVW9Mn4eUP0j574b80V5KX+EZBpVyYfIHo3MnoWptjqnL1bb1DNIxYMtG VoUHWvxdwCC35rXkhbzyF6V0otfIAmg9KB+TaowIkZA86Gr/ABcSxjU06jluDTDxea15KmueU3ZL Szt/IbTNBbIlnI2oyNGhf/SZo34sg+CWaRQzOOXbagwA+a15K13+X8Oo3UDXXlCeKbU5Wn1K/TU0 L2zS3TlvgpwkCx0bZehp9oVx4lpD3vlO/ur03x/L0LdSzm4uWfVOQbkSzBVVo1Ri3TYqOlPA35rX kzaz/L3ytcSnWLvSTb6rfxyyX8RuJX4yXkbLcR1Vgp2kZaqPcUyPEU0y7QbC10+zjsrRPTtrdFjh SpairsBViTlc2cUzytkmOh/71v8A8Yz/AMSGUaj6XI031fBPMw3OdirsVdirsVdirsVdirsVdirF rn/eiX/Xb9ebGHIOrnzKnkmLsVdirsVdirsVdirsVdirTAMCD0Oxwqo/U4fE/fh4iinfU4fE/fjx Fad9Th8T9+PEVp31OHxP348RWnfU4fE/fjxFad9Th8T9+PEVp31OHxP348RWnfU4fE/fjxFaVIoU jrx79ScBNqAvwJTHQ/8Aet/+MZ/4kMo1H0uRpvq+CeZhuc7FXYq7FXYq7FXYq7FXYq7FWKLLFeSN LaOtxFIzNHJEQ6sKncMtQRmw4hGO+zrCCZGkZFpjHeVqf5I6/fmLk1g/hDfDTd6KSytl/YqfE75i y1Mz1bxhiOioIYR0jX7hkPEl3lnwR7lj2lsw3jA+W36slHPMdWJwxPRCS6YRvE1f8lv65lY9Z/OD jz03cxb9Pte6e8tnY3REqARSgRDeVAUP95y/aB9s23g8MtyHXDLxRsApDGPM/wBUhM+nztcI4LPF qNwinnIW4lCX6LRd22zIPh3sRX9UOMBkoWN/6xWn9OSRKsWm3q8jUP8ApSepLAMNyOlP864+gHmP 9KFqdfSf9OWru18wSW8wtbO+jd0YwyNqcxZKVIcoT7/ZwxlCxZj/AKUIlCdGgf8ATlu2k1SX0ZYr C7eK5jV4D+lbjiwePkOo+0QCfY4yERtY2/ohY8RogHf+mXGTVIEDSaffcp1pEv6SuGG3J3Jb9g8F 22/HBUT1j/pQn1DpLf8ApFyW2vsprY3qnmEBOqz1BI477dOW/wDZiZQ7x/pQohPuP+nKgB5haS6j NpdtOzCaJBqc4MUcqlY1KjqOaMa/RkvRtuP9KGFTs7H/AE5VBbeZXYlbW9grIssTDUJpCI1CAoUc 0erbmtNj7YOLH3j/AEoZCGTuP+mLLYdY9S4ghazuIvrBISR1jKAqpf4ijsV2XuMwzjoE2NnNGTcC ju1q/mLR9IA+v3KQyOpeKIn4347UQdzU5SSBzbEMPOXl8wRz/W4fSmQyxN60HxKrMhK/vN6MjDbK zmi2eH5hCW3nS0u7qK0tbizkuZyFhjE6VZmoFH2upJ/HMQ5s3dH/AGX6kjGD1WP590lAA15ZhyeN PrEZ+IgED7Xvk/Gy1yj9v6kcA7wmmha5HqqzPG0TpHx4vC4kBDV3qKgdOnX6KVt085yvi4fhf6Qx lGmTaH/vW/8AxjP/ABIYdR9Ldpvq+CeZhuc7FXYq7FXYq7FXYq7FXYq7FXwXoXmrzJoE3q6NqVxY sSCyxOQjU/nT7Df7IZvZ4oz+oW6KGSUeRemaF/zkV+YdvGovrGDVoqVM3pPDIQNj8UX7v/hMwp9n 4zyNOXDVz6i2Wad/zlJ5fkp+kdEu7bx+ryR3Hb/L+r5jy7Ml0IbRro9QU5i/5yS/LpwSy30R8HgU /wDEXbKz2dk8mf5yDcv/ADkj+XKLVRfSn+VIFB/4Z1GP8nZPJfzkEj1L/nKTQ0r+jNDubjwNzLHB +CCfLY9mS6lrOuj0DBE/MTzV5hllj8t+XdMs3tgJWa3thLMq1ADVlLLsadEzaY8U+s5H3l108mMc oRHwtkGlrqK6XHb655VnvNRRneW5t2NtyAk4lSkPw7Go+Gm3bvmYL/n18j+lwTW/ov5j9CKhTTo0 mYeTdSDAhQpnmdVBelCW+yduI2wni/nj7P1oHDv+7P2/qV3v4VSBZvKV7KVjUUkk5UTcKqniTSjL 4fLAAd6n9360mQ2uH3/qWWE0TFIbjyrOHLn985KCkklIlIWJ6UHw1pvkpX0n9362Ma5GH3/D+FHS nTTJJG3l94WPJTwEzgGmw4+gKjmV7+GRHF/P+79bM8N/R9//ABLROnzXBWPy4ylq/Apn2J+EHe32 oyt1w+oD6/u/Wj0k/R9//EuU6eWavlwlY1YyA+sCByDA1Nv+zX8cHq/n/d+tPp/mff8A8SqabDpx u7NrjRHihTk9wRFLMroInUjgYV4/vVqN8EzKjUvx8+5MBGxcfsJ6Hy72Z6BY+WroJf6TZRo8bPGr iIxurD4WFCAR1pmDmnOO0z9rnYYY5bwH2Me/NDSppZbV5LQyxrGS0hTmEQEu5qPiU/Aqg9Kn3BFO KWOd2WzNGcaofjZINB8pwXXmDSrG60J1tXuSborBKVEFAY/j5oVBar1X7IapLVGOWEBEkHp3ssXE ZAEbX3dOiEuNFn0/UFFlpTIYZXYO9sWSJuZBOyVqF47fKnxHJRxYyP2sZSyCWw5Hu8y6PRPRaFho rNIjrMVEErcYyeCMVXYtxQEqrAEuKdQMZYce+/2sYzybXH7Pc9C/LPSSmkFJYDZ3LRLLJEYvSNXu LjizLU1qir8Q28Mwc2UYshrcOZhxmcN9izjSbeWG9cONvTNCOh+IY5MsZx2bMOMxlv3JxmO5bsVd irx7zr5zutK1iYXN7cwwSW981t6Cu9bqF4hbxnisgVCrvy2HTr47QY6iOEA8nSifFOXFIj4pFd+f Ut7e7lg84y300dvK1rbrpd9B6lwIm9JS7cwF9ULXbcHqOuRHGa/dgfJsIh/PP2qU35gSx2WplPNs s93BvpgGmXyJNSFWIYGvHlKzIKkU413rsQJWPQPPkioUfWftVLPzvf3Y1qQea/Q+pyXEml2j2dzz uLVFDQ1mlMCeq5biUC9QSBTAeIV6OfNYxib9Z+aNvvPekpDNJaecrqV19d4YG029BYFR9Xj58AAy tXm9KN4LkY+J1xj7GRjj/nySfX/zI1GF1fy/r9xqJe8WFbKewuoXFuWP7z1iwRu37K/IdrcUSfqg A15OED0zkXvegzyz6RbSzMXkZfiY9TQkb/dmvzxAmQHZaaRljBL4GZSpKsKMNiD1Bzdumeh+WfMk Nr5ct7L9LWFnKElX98+rCVDI78WItyYeSj7PFSN1qCa0x5wuV0fsczHkqNWPtVhd+UxeIzHyw6yR vyHo6v6alGUAnbnyerEbUoPlgqVfxfYm43/D9qGUeTkeK2N1oHBo4udyIdXcA28oc1qA3K4DkPTY KuxU0w+rz+xj6P6P2pD5pv8ASJIYYdPt9OBnEdzNLYx3SNCxjCG2JuWNQCvM0rueuWQB6215ZDpT HMsaEdpOu6xo8zzaXdy2c0i8XkhbixWtaVHvhtBjaZr+YfnhemuXY3J/vT1JqT9+N+Q+QRw+/wCZ b/5WL563H6cvN9z+9b5435D5BeHzPzLm/MTzy32tcvDuDvK3UUIP4DG/IfILw+Z+Zc/5ieeHjMb6 1dOhZJKM9TyjPJSCd9m3+eIPu+SmN9/zLv8AlYvnnkG/Tl2SPGQnw8fkMb8h8gvD5n5lP9C/OjzL p8jtfRR6n6yhJpZHmimKqSQA8bhRQsafB3yMhf4DONBm+j/nl5HnAGrWOp2Tnb9zcyXCCuxqxlib /hMpn4n8PD+Pg2wGM8+L8fFmml/mJ+TVyoWLXJIWY1KXE17BRiampYqn45hZJ6nuHyi5UIYO/wC0 su0jzH5FjhMWmazYSIzF24XkcrFjQEkl2bMHKMszcgfk5eMQiKinHr2t5FLDBcRuWUglGVyvIUrT f8cx5RNdzYklz5c02JlM11HADXiGSJKkADao7ZR4OQ/xyY8KCupPJFqy/Wtb0+34fC4kltUqVFGr yOxrvlg02U8jNB4RzKV6n+ZH5M2auk2pWkpoRxtkkmJ26BoVYfTXMyGkynkD82Es2MdWFWv/ADkB 5Z0G1uE0+yk1OSeZnQ/7zmiqq1lZlc/EasAAeNSvQCuQdBKUyTtsP7Ph+lo/NxHLdkP5PfnHrvnf zpeaddWlvZ6fBYS3MUcXNpOazQoOUjGh+GQ9FGTzaSOKNg2WWDUGcqrans+YrmOxV2KvGvNeqa3Z 6rdJp+jSakPUJ5rPDCAS7hl/eGvw8R275usf0j3PN5R6z7ylR8weaA7L/hiYgNIAwurahVa+mftV q21R298nTXQ70s1a+83Xstk6aLqNm8XMlLW9tVR23ZVlqJAVPpgV2pyI32qWQpR0pfOVgPXOn6pe SJ6zLbXV/ZujswjVQxCggfaIp0p74qaTpvMnmBJJBJ5auljjillDrNA5Zo/soFRm+3t7+xpgpjQ7 1bT9a8w3NzZpPoL2lvOpNzO9xE3on01dfgHxNVyU7EUqRipAew+WwRolpX+U/wDEjmo1H1l3+k/u g+fZ/wDnFbzJJPJINbswHYsAUl7mvhmYNdHuaDoiTzWf9CpeZf8Aq92X/AS/0w/no9yPyJ73f9Cp eZf+r3Zf8BL/AEx/PR7l/Invd/0Kl5l/6vdl/wABL/TH89HuX8ie93/QqXmX/q92X/AS/wBMfz0e 5fyJ73f9CpeZf+r3Zf8AAS/0x/PR7l/Invd/0Kl5l/6vdl/wEv8ATH89HuX8ie93/QqXmX/q92X/ AAEv9Mfz0e5fyJ73f9CpeZf+r3Zf8BL/AEx/PR7l/Invd/0Kl5l/6vdl/wABL/TH89HuX8ie93/Q qXmX/q92X/AS/wBMfz0e5fyJ73f9CpeZf+r3Zf8AAS/0x/PR7l/InvQ5/wCcVfOdTx1bTiOxJnBp /wAijj+ej3FH5GXe7/oVbzr/ANXXTf8Agp/+qWP56PcV/Iy73f8AQq3nX/q66b/wU/8A1Sx/PR7i v5GXe7/oVbzr/wBXXTf+Cn/6pY/no9xX8jLvd/0Kt51/6uum/wDBT/8AVLH89HuK/kZd7v8AoVbz r/1ddN/4Kf8A6pY/no9xX8jLvd/0Kt51/wCrrpv/AAU//VLH89HuK/kZd7v+hVvOv/V103/gp/8A qlj+ej3FfyMu93/Qq3nX/q66b/wU/wD1Sx/PR7iv5GXezv8AJz8lfMXkbzRc6tqN7Z3ME9lJaBLd pS4Z5YpA3xoop+6p1yjUakTjQb9PpjCVkvZMw3LdirsVQ8um6dK5kltYZHb7TtGpJ+ZIyYySHIlr OGBNkD5LP0RpX/LFB/yKT+mHxZ95R4GP+aPk79EaV/yxQf8AIpP6Y+LPvK+Bj/mj5O/RGlf8sUH/ ACKT+mPiz7yvgY/5o+Tv0RpX/LFB/wAik/pj4s+8r4GP+aPk79EaV/yxQf8AIpP6Y+LPvK+Bj/mj 5IpVVVCqAqgUAGwAyttApvFXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq 7FXYq7FXYq7FXYq7FXYq7FXYq8I1j82fOdrq99bQ3EQiguJY4wYlJCo5UfgM6bF2bhMASOYeVzdq 5ozkARsSg/8AlcPnj/lpi/5FLln8l4e5q/lfP3j5O/5XD54/5aYv+RS4/wAl4e5f5Xz94+Tv+Vw+ eP8Alpi/5FLj/JeHuX+V8/ePk7/lcPnj/lpi/wCRS4/yXh7l/lfP3j5O/wCVw+eP+WmL/kUuP8l4 e5f5Xz94+Tv+Vw+eP+WmL/kUuP8AJeHuX+V8/ePk2Pzg88npcRH/AJ4r23yJ7NwDn97Idqag8vuX H82/PqhmaVAq05Ewigr0rg/k/T/gsv5S1Xd9jj+bfn0NwMqBqV4mEVp40x/k7T1f6Ufynqbrr7mj +b3nsIHM8YQrzDGFaFf5q+GP8naf8Ff5T1P4Df8Aytvz9VR6qVYlVHoDdlHIge4Brj/J+n/BT/KW q7vsbH5s+fyaCRCTXYQD9k0b7id8H8n6f8FP8o6ru+xr/lbnn3lx9ZOQ2I9EVrh/k/T/AIKP5S1X d9i0/nB55BINxECOoMS5IdmYD0+1ge1tQNj9zX/K4fPH/LTF/wAilw/yXh7kfyvn7x8nf8rh88f8 tMX/ACKXH+S8Pcv8r5+8fJ3/ACuHzx/y0xf8ilx/kvD3L/K+fvHyd/yuHzx/y0xf8ilx/kvD3L/K +fvHyd/yuHzx/wAtMX/Ipcf5Lw9y/wAr5+8fJ3/K4fPH/LTF/wAilx/kvD3L/K+fvHyZj+Vvn3zH 5h8wXFlqcqSQR2jzKFQKeayRqNx7Oc1/aOjx4sYMRvf63Zdl6/JmyGMuXD+kPUs0rvXYq7FXYq7F XYq7FXYq7FXYq+V/MX/KQan/AMxc/wDycbO1wf3cfcHg9T/ey/rH70uy1pdirsVdirsVdiqbaNrE VhDcK8ZeRirQsDShKtHIpr1Vo5D9NMxNRpzMghztJqhjBBRN55lLhPReZirQyPJI55yNHO8xLUr0 DhB8spjpJeXX7nIlr49L6fesvtfR2Y25kkf6pJbrJOaNykYtuVJNN/vP3zGlPDRrnf2MDrY8di/p r7bVdQ8xW11pjWUYmhIjKLLUFmWi8YzQJRAF4jr0r7ZCOkmDexZy12MxocQVJfM1obSFIhMk8V0b tXAUU5mNXTkGqP3asKita0pvkfyc/LuZ/n8Z7+9uDzRaotpGyShInrMeQP7plcPEoovwFyHIbq3h x3P5OXkx/Pw8/wAWsg80wxI7LHIk7SN+9RgD6ThDTp9pZIgymuJ0UvJI7Qh3FKNWvI7u9aaMNw4R oGfd2McaoXb3cqWPzzMwYzCNF12pyic7CDy5odirsVdirsVdir0b8i/+Utu/+YCT/k9Dmp7Y/uh/ W/QXc9h/3x/q/pD3PObepdirsVdirsVdirsVdirsVdirFrn/AHol/wBdv15sYcg6ufMqeSYuxV2K uxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxVMdD/3rf8A4xn/AIkMo1H0uRpvq+CeZhuc 7FXYq7FXYq7FXYq7FXYq7FWLXP8AvRL/AK7frzYw5B1c+ZU8kxSvW/MOn6Nbvc3riOCIBpZWNFUM eIr17nJxhbVPLwmmOf8AK4fI3/Vxi+9v+acl4RY+Me5fF+bnkuaRYor6OSVyFRE5sxJ6AALU4+EV 8Y9zT/m95JR2R9QjV1JDKSwII6gjjj4RXxj3L7f81/J9zJ6dteLNJ14Rh3brToEPjj4RXxT3KZ/O DyOCQdRiBGxBLf8ANOPhFfGPc1/yuHyN/wBXGL72/wCacfCK+Me5lelara6nZx3dseUMqrJGw6Mj jkrD5jISjTZCfEjMizQ2pahb6fZyXdw3GGJSzt2AUFiT8gMlGNsJz4RaS3PnnSbYxCdZE9YkRH05 SGYGhUEIfiBNCvUZLw/Nh4h7lGP8xNBkeFEZ2a4/uAI5fj+Ev8Pwb/CCdu2Hw18U9y1vzJ8uLE8r SMsUYrJIY5QqjiH3PCg+Eg/LHw18U9yIfz1pKW8VyRJ6M54xOI5TyO1BQJXfkKeODw/NfEPcp3f5 g6HaW8dzcs0VvLGJ45mSQI0TUo4bhSnxjHw18U9yl/ysry3v+8b4aV+CXaqGQfsd0HL5b4fDXxT3 Kp/MHRBai7PqC2JZRMY5eBKAs2/CnwgVOPh+a+Ie5PtO1CC/tluITVHAIPiGFQR8xkJRpnCfEETk WaY6H/vW/wDxjP8AxIZRqPpcjTfV8E8zDc52KuxV2KuxV2KuxV2KuxV2KsWuf96Jf9dv15sYcg6u fMqeSYsL/MbTbbUtH1Czurn6pbPCHmuePPgkREjNxqK7Jl+Pk4eY+t5GPyq8s8VZvNUUZdFlCSok bhHUOpZHlVlqpruMttjxnuRuh+QPL+m6iL2081Wsktv6kTpIqcCJYmR1PGdW/u3O6mo7GowHdIyE dGT+tpKRSibWtHaaZ5eUssKgU5mRwa3AJZWpxYtXiN+QyPCz8c9y3hbWd/e3q6/pNvPeLb2sypax qEFu54oqieo5Ns4PgOnHZ4UeMe5h8v5W+W2lLS+boDLK1SW9LkzMT4zbkkHJ2w4z3Lo/yi8vSzRw ReaIXmlp6USrEWaq8xxUS1NV+L5Y2vGe57d5NsBp2jwaeH9QWcMMAkIpy9JOHKm9K0yjI3ac82QI hY0Hz8MqJpyQLY9+YSovlHUvi5H6vPUDw9F+5yeI7tOoGw97xLyl5k8/+YYnh0zU0gurV19NWjhD zS3Bdnd39FgPgR2durUFanfLpCIWJkU3tfL/AObWpC0hu7+OOAkmMyeg4WSG2YRqxEPFuSScDuep ruMFxCal3r/0Z+at369vf61HFBcwTy85FjIkjeF0fl+4BjDRxCpalOX81cFx7lqXeh4o/wA4ZIy8 eowqLea4nPBrUH14WNrNUrB8TF5GU12r8R6gk+lFSai0z8zNamv/AC5e6mgmjtIYzFS3ZZInWT00 aZYldfssvLf7X8pLY3EbrUuVo/SNJ/N7Vr22aTWIre2ZVvEvV+rkAUIjIRYUY8ggqOlKV8MBMQkC XewvVvNvmnRbbT4U1ZphPZBAnpQh44lYxhGZ4ix/utmrXYH+U5MRBYkkdX0D5Kp+gbWnT0Iaf8ix lWXmxwdU/wAqchMdD/3rf/jGf+JDKNR9Lkab6vgnmYbnOxV2KuxV2KuxV2KuxV2KuxVi1z/vRL/r t+vNjDkHVz5lTyTFjfmeF5kuoY44pnkgZEinFYnLKQFkAr8B6N7Zfj5OFn+p482uaemp3Z1e38vJ d2oNu9be5kb1LaNo0ABRgEEi8eXXiKb/AA5aivegZvMeleq8cVn5cjWKTiym1uDyUfCaEw7r8W9O 2NLXvRDa3pLBr+G10F9MkeKF43tH5Q3MlsxQN+6Q+mZo2JO54DpXbFa96gfM2nyRyTS2/luaaSVn laW3unklbkzOxYxdXrVe36g0te9ZH5htW09tVOleXRGkiW80ZtpyyM/qPHVVRl34MaitcVr3p75H 1K91rUxeWVjozS2ZgW+u0injnWNkMX7ksgAPpR0Cjb78BRIU9m0EoEm5LXde9PHKMrfpuRTiMxnl xUg8W717fLKTbliki80PZLpLfXnjS0ZgkxmIWMq4KcWLbfFWmXY+bi6jl8XiFtqHlxSsd55a0oOI nneSO6teFEiduC/G/wAXqKEr9OZDRR70XBP5YkguC/lXTI7mKNHhg+v2Teq7S+nwDA7U3NSO1OuK N+9SmuNCBAh8paW5qPh+v2RJViKdG60/EjFd+90V35edn/51LTChY+kw1CxpxCmpY8j3Q9P4Yrv3 rzP5ZeRoovLOlBo4ublr20IEpg5+lSqn++Kx8unfFd+9bBN5Zlt7KeXy9pNspldNSrPBMY4o2jUy IsTFjXm3Y0pvsa4rv3t2t55XlWCafylYQ2k3x+sLyzY+mCwZkSql6NGwoOtMV373s3liS0ksOdm6 SWvwiF4iGTiBQcSu1Nsoyc2/T8inGVOQmOh/71v/AMYz/wASGUaj6XI031fBPMw3OdirsVdirsVd irsVdirsVdirFrn/AHol/wBdv15sYcg6ufMqeSYoC/01riUSI4U0oQfbLIzpoy4eI2EIdClPVkNf n/TJeIGv8ue9bJ5dMqMknpOjgq6sKhgdiCCN64+IF/LnvVF8uSRoF5RRqv2UAO1PYDbB4oT+VPe5 vL0ihaulCKjY/wBMRlCnTHvcfL8vCoeMrXpQ9fux8UL+WPe0NCmHR0Hyr/TD4gR+XPemNjYG0i3b k0m5p0FNsrlKy348fCEXD9v6G/UchLk2x5pfrGk2mrWL2V3Ek0DkM0Uqh0JU1HJTsd98nGVFryQ4 gx0fln5bZgP0Vp9Sf+WePv8A7HLPFaBgl3t/8q28uqdtK08FTt/o8fjX+XHxV8CXe0Pyx8tROWGl 2HJ6P/cIaGgApVdvsjpgGVJwS713/KsvLa8f9xmnLVdv9HToajsmPjL+Xl3tn8r/AC8aU0rT3A6U gjP4ccfGC/l597ovy60GBw0WmWMbr0ZYEBHTvx9sPioOCXe0/wCXegusaPptiyxL6camBCFQsX4j 4dhyYn5nHxV8CXeyHRNMttIshaWsUccCmqwxoEjX2VRSmVTPEW/FHhCYVhbqCh8RuPxyO7bsj9GV VumbkCOBG3XqO2UZz6W/Tj1J1mI5rsVdirsVdirsVdirsVdirsVYtc/70S/67frzYw5B1c+ZU8kx bAqQPHbFQvPpISKF2HjsPwyO5ZbBczqspXgtAad8AGySd1OXaRx7n9eSHJiebcn2Y/8AV/icQpcP 7k/6w/UceqeizCxXv/dx/I/rwDmyPIOh/vB8j+rGXJY81mFiuj+2vzGJ5JHNzA8mPauIUty9V/1V /VgisnSVPAf5Ip9+ISVm4PgcLFeJpOhPIeDb/rwcITxF3OM/aSh8VP8AA40U2G+CH7L/AENtjZWg 00UgFaVHiNx+GPEEcJRui/70yf8AGM/rGU6jl8W/TfUfcnuYbnOxV2KuxV2KuxV2KuxV2KuxVi1z /vRL/rt+vNjDkHVz5lTyTFsGhBxUOuXEZlc9E5MQPAb4x3pZmrLFL780fKltJftNJMP0fLHDdUiY 0klrwUeP2evTJjCaajnBLeq/mb5ZsNYXTrr6xHNKwAk9EmIM4LKhcGlSPDCMRpfHB3QUX5y+TZ4L WQm6hink9GOWaAohJI+LkTTiOa1PviMJScwZPpPmCy1O2je3SVUuAJIjIoU8aEgkVqKjcZGWMjdY 5gdkfkWxe392n0/rwDmyPJ0P94uMuSx5rMLFfEjl1IU0qN6YCQyAKF1nW7PRNNur29WT0U6iJC7G uwAUbmpxjDiIpEpiINsTm/N7yl+i01ILdmHm8DoIGLo8IBk5itFCgjeuWjCWo5wi7780PKljNYCa Sbjdxxzo6xFlWF2VUkkP7CszhQW74PBO6jOPNQf86PJIa7ZjdfuwoRTAQZQzmINFU/EvMUrkfAky /MRvkWRaH5g0rXtJi1DTuZhkCsruvEkNy7V7FcBiYndMcgkNuiYrEWjZ6/Z7YDLemYjtbjBICBSp YVFMeILwl0XJXYHYhWqPowFQjNF/3pk/4xn/AIkMrz8vi3af6j7k9zCc52KuxV2KuxV2KuxV2Kux V2KsWuf96Jf9dv15sYcg6ufMqeSYuxVK5PM3ly6OoRrqMCfVJHt7wyMI/TcMI2/vONR6jcOQ25bV rhiCKWdG2H6r5Y8hXjaqJfMUKjXTbSylbm2FBZsqKYq125pxbrvtloyHuaPAA6oCbyn5MuZoNQ1H zh9ffT4zcySpPbmNQDx5ggO0an1FXirAOabE4jIe5JwgdVSx8hflvZW0sJ16C4S7ljkmEk1oKi3U lUAjCBaq/wAZHxMDuaHHxD3KcI7078q2fkfyrp8kVv5ggliiZ5mae5gZqMorshXtToNya9TkJTJ6 Mo4aN2zDTL3S9UWRtOv7a8WIgSm2lSbiTuA3AmlcqMq6N4haYi0XiqsxNK9NuuQ42fAuS3iU1A3H c5EzJSIgLwiL0UD5DBaaSPzJ510Hy5dWFvq0rQLf+qY5+NY0EPAMZDXlu0qKKA7nwqclGBlyQZAM W87/AJhfl7cxXWg3euyWVxGzx3E1vHOJIpI34EBxGwryB8RT2O9+GEhvTRnIkKYS2m/lU/lprGLz PcjT0vOF3KkVIzNdIzhGiMPpBKQkxlUorDY1y/il3NHhjnaFmf8AKG6uLb1vM99LGVSJlkRwDArh 0t3LRcgkcsANevxdadHil3L4ce9u/wBJ/KixutQ0+98zXrTG5Buy0McpW4jkcH1j6JMioyEENVd/ pwcUu5Phx72YeWfO35WeXNETTLPXzNHbgKTNHMXorHeojANTLtTbw6ZCQlI8mcBGIO/NmXlnzf5c 8xWt5+hb1bz6qU9firrx9QEp9tV68TlM4kEW3RIIKen++h+R/VlfQs+oUG/vpfk2THIMOpRWi/70 v/xjP/ElyGo5Nun+r4J7mE5zsVdirsVdirsVdirsVdirsVYtc/70S/67frzYw5B1c+ZU8kxXRxmR uIND74CaSBbFfOnku+mjZvLmjaLcS3tRqRv4yrOTPHKrVjHxr6gaSQMdyB1O2MMo62ylj7kp1nyp rVpC076B5WOnWQuv3s8MixwafGVkSvFWId+czuFTjXetThGQHqVMPIJdEdKEHq2q+SFtLqER3Q48 DJI0SNFGynf0zeCtT+wobr0O/wDSWh5OGlG/vYrTTtO8j3c8PHnBGH9T1hbp66iOMNyVSWArXYAk AjG658S/JHWfkDzDHpsvr+W/Kb6m80QEpt5fR9EIwkJX014sGWPiF2+0Tv1BmL5leHyDOfLuj6Vo 9mpttNsdNvbiOL9ILYIscbSou4BVQzKrM3HkOmVys97IEBOEdpBVSKdOhP8ATIEUyBtdxbu5+imC 00g2uW3FPvJy0QajNDXy3dxaTRWky2t3JG6W10Y1k9KRgQknBtm4tQ075KgjiLFZvK/5jy+q483Q 8QTxB0yHapPjIfEfd98hKI6IIkeqnbeWPzEFzZy3/myN4o2SW4t4bCFOY/bQSE+BIDFfA0wiUe5B BVovLPn5bV4JPNUMl48kTwXX6NhUJGFYPGUD0bkWUhuo4++DiHctHvRFr5X88I9ytz5niuQY4hF/ uPhj4Oro0j7O3LmodaHpyr2weIO5lwG+aXS+SfPrpJ6vm8S28oIEb6dAVPI1YOOfxKxHQ9tum2TE 43yY8J5swso7mGzijlk9WVUVZ5lT01dwAGfgCQvI70rtkDVpFogTyBlY7lelcHCE8RbVuRlY9SpP 3kYK5KDzRei/70v/AKn/ABsuV6j6W7T/AFfBPcwnOdirsVdirsVdirsVdirsVdirFrn/AHol/wBd v15sYcg6ufMrorWeXdV+H+Y7DITzxjzLKGKUuSLg08owdn3HYD+OYs9ZfIORDTVzKINsP52/D+mV nUkdGzwR3qVzpttc28lvOomgmRo5opPiR0YUZWU7EEGhGWxzlgcIY7qPkfyvJM8s2g6fKXNWla0g Yk7mpJSvUnMnHnB2vdx8mMjor6V5V8sWl3+krXSLODUOTn63HbxJLVwQxDqob4gxrhySPK1gBzTa 6/uG+j9eRhzZT5IYrB9XqP7z8fuyze2uhXmrWf8AdH/W/gMhk5s8fJEZWzSxvtH55khxi3H9tfmM TySOa4ysodBSjHfBXVN9GpP2f9UYhEl/+74/9h/DB0LLqFdmVZJmYgKFqSdgABlfQM+pQb6hYG0j pcxHf+dff3yY+pBB4UInmHS1t5AZGqegCt2+jMSWshfKX+lP6lETSq2u6SWiYyVXieQ4mvTwphGq jX8XyKTHcLrS/tbsXJtiSiUBJUqNz03GW4s4ycr27wR97AirTPRf96m/1P8AjZcOo+lt0/1J7mG5 zsVdirsVdirsVdirsVdirsVfJHlr/nITzdpkijVoYNahBHJpR6U9PaRBx+lkObjLp+IUDwunx56N kW9Q0X/nJPyHeKq6jFdaXKftl4/WiHyaLk5/4DNZPs7IOVFzY6yB57My0/8AM78vdQUG28w2O/RZ Zlgb/gZeDfhmNLTZBziW8ZoHqE5h1zRZ15Q6hbSqNiyTRsPwOQlCXczBDcutaPCvOW/t41rTk8qK K/MnLowNcmBISPUvzR/LvTlLXPmCyNOqwyi4b/gYfUb8Mfy2SR2BR40BzIYRrP8Azkj5DteS6ba3 eoSV2dUWCI+/KQ8/+EzNxaTLW5cWeox9GIah/wA5N6nLVbPQoIYz09ad5T/wqxZlx01dXHlnvohI P+clvMikevpNnIKjaNpYzT6WfJflx3sfH8mQ6N/zkxoxfjqmiz2yN9qS2lWfenXi4h2+nK56c9Cz jnHV6d5Y8/eUvMyD9D6jHPNSrWrfu512qaxPRqDxG2Y8sZjzb4zB5I5/tt8zlwaTzdH9tfmMTyUc 2m+0fniFK6X9j/VGAJk6b7f0L+oYx5LLm89/M575p7aKDUbm0SSIxyQQOwSXm+/qIGTkoRW5f50n HDxDbo0zy8JCSaVL5n1G+0nSYvOOpF55pLUTAuGKo3qM7lroM5Uy8GJpQABeRAyrJpqBl5W3QzGR ABPOvxuowaj5n0nU7aSXzLql20E3L0WlmkWQLIUVWjeZlIqorXrWmT/K2OjH8zwyq5c/x9ymt1rz ei8vm/V+LTBOEck3J+icUpchW5srcTUAgV64nSEXyYx1INbnc/jqz38tY7y50iW7lvLjUZblEcXF 0/qSFVnnjUBy8hZQI9qn6KZjkjHkIJciNzhYZvowIu2B2ITcf7IYc59LLT/UnuYbnOxV2KuxV2Ku xV2KuxV2KuxV+e2dA8+m9nD5Ua3tzeXV7HcEN9bSGCJ1BEqBPTLSpWsRcmtKNQdMG7IUiZbXyH9U maLUNS+tgSGBGtYfTJBPpB2E9RyFOVAae9NxunZVltPy6rGItR1Ujl+9ZrSDZOJPwgT7nlQb47r6 VKG28hlpBNf6kijl6bJawuSPUcLyBnT/AHXwJ361Hgcd12SS5W2WYi2d5IaLR5FCNUqOWwLdGr3y TEqWKHYq7FXYquillikWWJ2jkQhkdSVYEdCCOmKXoPlv88vOukhYryVdXth1W6r6tK9pl+In3fll ZxAsxkL0rQv+cg/J92yLqcNxpclRyYr68Q/2Ufx/8JlUsRZxyBnGk+cfKWsEHT9Zs5mc/DGZ0ST/ AJFuVf8A4XKZy4eYPybox4uTJhpzOFLOAAoG2+YktWByDeNMTzKIFjbg8mHI7dfYUyiepnyGzdHB FAa55a0fVbdhdWgnlSN1hoxjYEgj4WGyncitO57E5XHU5IWYnf70zwwlzDHofJ0trfw3ltp8Yngo 0UrmNipQfAaEcSwLEg061bqcqn2hqjtQr8ebWNPEGxELJ/y/t5pllawiLPVneqqULCpC8fAkjb6M l/KGq22H4+KnTx7gjH/LfSGV+Pp8nj9IcouS0BqPh5DuST3NTvucvGuzdSPkf1p/Kw7glegeaPJ3 lm0u/wBKajbacySeikBZd1SshEaqPUlZXlYO1DU/5JXJZI5Mkz12Hy3/AG/i1iYQ22CZ+TfzU8n+ a/M02kaG01xPBbPcvdtEY4jGkkaEDmVkrWQdUyf5fJCPq5dywywlLbmz7K3IdirsVdirsVdirsVd irsVdir4iufyv/MP6xLw8tajw5txpbS0pXanw5uxnh3h0xwTvkpf8qv/ADG/6lrUv+kWX/mnHx4d 4R4E+53/ACq/8xv+pa1L/pFl/wCacfHh3hfAn3O/5Vf+Y3/Utal/0iy/804+PDvC+BPud/yq/wDM b/qWtS/6RZf+acfHh3hfAn3O/wCVX/mN/wBS1qX/AEiy/wDNOPjw7wvgT7nf8qv/ADG/6lrUv+kW X/mnHx4d4XwJ9zv+VX/mN/1LWpf9Isv/ADTj48O8L4E+53/Kr/zG/wCpa1L/AKRZf+acfHh3hfAn 3O/5Vf8AmN/1LWpf9Isv/NOPjw7wvgT7nf8AKr/zG/6lrUv+kWX/AJpx8eHeF8Cfctf8svzEReTe WdTI/wAm0mY/cqk4fGh3hBwT7ip/8q6/MH/qWNW/6Qbn/mjHxod4+aPCn3H5O/5V1+YP/Usat/0g 3P8AzRj40O8fNfCn3H5I/T/LP5vaaQdO0rzBZEdDb297F/xBVyMpYjzMT8mYjkHIS+1P7XVv+cir UUjh8wt/xls7ib/k5E+VHHgP81sE8w7/AJJpH53/AOcllrysNUkr/No42/4G3XK/y+n8vn+1kMuf uPydJ53/AOclXpxsNUjp/Lo43/4K3bH8vp/L5/tU5c3cfkl13rf/ADkbdV9WDX1rUn0bGaHr/wAY okyYxYB/NYmebz+SQaj5e/OPU6/pHTPMN7XqLiC9lG/+upy2MsUeXCPk1mOU8+L7UuP5efmGVCny zq/EbgfUbmgr1/Yyfiw7ww8Kfcfk9W/5xu8q+aNH883tzq2jX2n28mmSxJNdW00KFzPAwXk6qK0U mmYusnEw2I5uXo4SEtweT6RzWuxdirsVdirsVdirsVdirsVdir//2Q== proof:pdf uuid:65E6390686CF11DBA6E2D887CEACB407 xmp.did:fae80c9f-4825-4b71-8b01-b2e30dc55260 uuid:d58908e0-37b5-bf47-acdc-a65266fd1c23 1 uuid:bb4ff832-61ae-964b-98ee-08f325913107 xmp.did:0841a130-1ca0-43a7-8387-d0fb64abbda4 uuid:65E6390686CF11DBA6E2D887CEACB407 proof:pdf saved xmp.iid:3b19e4cf-75ee-499d-9ced-b677b0a8a75e 2020-10-28T12:12:06-03:00 Adobe Illustrator 24.0 (Macintosh) / saved xmp.iid:fae80c9f-4825-4b71-8b01-b2e30dc55260 2020-11-13T14:59:23-03:00 Adobe Illustrator CC 22.0 (Macintosh) / Web AIRobin Adobe PDF library 15.00 False 21.0.0 PDF/X-1:2001 PDF/X-1a:2001 1 True False 15.000000 10.000000 Centimeters DKLongreach-Regular DK Longreach Regular Open Type Version 1.000 False DK Longreach.otf PublicSans-Medium Public Sans Medium Open Type Version 1.008 False PublicSans-Medium.otf PublicSans-SemiBold Public Sans SemiBold Open Type Version 1.008 False PublicSans-SemiBold.otf PublicSans-Bold Public Sans Bold Open Type Version 1.008 False PublicSans-Bold.otf PublicSans-ExtraBold Public Sans ExtraBold Open Type Version 1.008 False PublicSans-ExtraBold.otf PublicSans-ExtraBoldItalic Public Sans ExtraBold Italic Open Type Version 1.008 False PublicSans-ExtraBoldItalic.otf PublicSans-Black Public Sans Black Open Type Version 1.008 False PublicSans-Black.otf Cyan Magenta Yellow Black Default Swatch Group 0 Branco CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Preto CMYK PROCESS 90.625000 78.515625 61.718750 96.875000 Vermelho RGB CMYK PROCESS 0.000000 94.531250 91.015625 0.000000 Amarelo RGB CMYK PROCESS 9.375000 0.000000 94.921875 0.000000 Verde RGB CMYK PROCESS 64.453125 0.000000 100.000000 0.000000 Ciano RGB CMYK PROCESS 56.640625 0.000000 15.234375 0.000000 Azul RGB CMYK PROCESS 92.968750 74.218750 0.000000 0.000000 Magenta RGB CMYK PROCESS 41.015625 77.343750 0.000000 0.000000 R=193 G=39 B=45 CMYK PROCESS 16.796875 94.531250 81.640625 7.031250 R=237 G=28 B=36 CMYK PROCESS 0.000000 94.140625 85.156250 0.000000 R=241 G=90 B=36 CMYK PROCESS 0.000000 75.000000 88.671875 0.000000 R=247 G=147 B=30 CMYK PROCESS 0.000000 50.000000 90.625000 0.000000 R=251 G=176 B=59 CMYK PROCESS 0.000000 36.328125 81.640625 0.000000 R=252 G=238 B=33 CMYK PROCESS 6.640625 0.000000 85.156250 0.000000 R=217 G=224 B=33 CMYK PROCESS 23.046875 0.000000 88.671875 0.000000 R=140 G=198 B=63 CMYK PROCESS 52.343750 0.000000 87.500000 0.000000 R=57 G=181 B=74 CMYK PROCESS 71.484375 0.000000 87.109375 0.000000 R=0 G=146 B=69 CMYK PROCESS 83.984375 14.453125 92.187500 2.343750 R=0 G=104 B=55 CMYK PROCESS 89.453125 32.421875 92.187500 24.609375 R=34 G=181 B=115 CMYK PROCESS 73.437500 0.000000 68.750000 0.000000 R=0 G=169 B=157 CMYK PROCESS 76.171875 4.296875 44.921875 0.000000 R=41 G=171 B=226 CMYK PROCESS 70.703125 12.890625 0.000000 0.000000 R=0 G=113 B=188 CMYK PROCESS 86.328125 49.218750 0.000000 0.000000 R=46 G=49 B=146 CMYK PROCESS 97.265625 89.062500 0.000000 0.000000 R=27 G=20 B=100 CMYK PROCESS 100.000000 96.484375 32.421875 21.875000 R=102 G=45 B=145 CMYK PROCESS 75.390625 92.187500 0.000000 0.000000 R=147 G=39 B=143 CMYK PROCESS 53.906250 92.578125 0.000000 0.000000 R=158 G=0 B=93 CMYK PROCESS 32.421875 100.000000 23.437500 16.796875 R=212 G=20 B=90 CMYK PROCESS 9.765625 98.046875 40.625000 1.953125 R=237 G=30 B=121 CMYK PROCESS 0.000000 92.968750 14.453125 0.000000 R=199 G=178 B=153 CMYK PROCESS 21.875000 27.343750 38.671875 6.250000 R=153 G=134 B=117 CMYK PROCESS 35.156250 38.671875 46.484375 21.093750 R=115 G=99 B=87 CMYK PROCESS 44.531250 46.875000 52.343750 37.890625 R=83 G=71 B=65 CMYK PROCESS 53.125000 53.906250 55.078125 53.906250 R=198 G=156 B=109 CMYK PROCESS 20.312500 37.500000 59.375000 8.593750 R=166 G=124 B=82 CMYK PROCESS 27.734375 46.093750 66.796875 20.703125 R=140 G=98 B=57 CMYK PROCESS 32.421875 53.515625 75.781250 32.812500 R=117 G=76 B=36 CMYK PROCESS 35.937500 60.156250 85.546875 44.921875 R=96 G=56 B=19 CMYK PROCESS 39.062500 67.968750 94.140625 57.031250 R=66 G=33 B=11 CMYK PROCESS 47.265625 74.218750 82.031250 72.656250 Black 0 PROCESS 100.000000 CMYK 91.171128 78.686196 61.953151 97.448689 RTF r0 g0 b233 PROCESS 100.000000 CMYK 94.555581 77.209121 0.000000 0.000000 C=50 M=0 Y=85 K=0 PROCESS 100.000000 CMYK 50.000000 0.000000 85.000002 0.000000 Cinzas 1 R=0 G=0 B=0 CMYK PROCESS 90.625000 78.515625 61.718750 96.875000 R=26 G=26 B=26 CMYK PROCESS 75.781250 66.406250 60.546875 82.421875 R=51 G=51 B=51 CMYK PROCESS 68.750000 59.375000 55.859375 65.234375 R=77 G=77 B=77 CMYK PROCESS 61.718750 52.343750 50.390625 47.656250 R=102 G=102 B=102 CMYK PROCESS 55.859375 45.312500 44.531250 32.421875 R=128 G=128 B=128 CMYK PROCESS 48.828125 38.281250 38.281250 20.312500 R=153 G=153 B=153 CMYK PROCESS 41.015625 32.031250 32.421875 10.937500 R=179 G=179 B=179 CMYK PROCESS 32.421875 24.218750 25.390625 4.296875 R=204 G=204 B=204 CMYK PROCESS 23.046875 17.187500 17.968750 0.781250 R=230 G=230 B=230 CMYK PROCESS 11.328125 8.203125 8.984375 0.000000 R=242 G=242 B=242 CMYK PROCESS 6.250000 4.296875 5.078125 0.000000 Grupo de cores da Web 1 R=63 G=169 B=245 CMYK PROCESS 66.015625 22.265625 0.000000 0.000000 R=122 G=201 B=67 CMYK PROCESS 56.640625 0.000000 86.718750 0.000000 R=255 G=147 B=30 CMYK PROCESS 0.000000 50.781250 87.890625 0.000000 R=255 G=29 B=37 CMYK PROCESS 0.000000 91.406250 79.296875 0.000000 R=255 G=123 B=172 CMYK PROCESS 0.000000 65.234375 3.515625 0.000000 R=189 G=204 B=212 CMYK PROCESS 30.468750 14.062500 14.453125 0.390625 PDF/X-1:2001 endstream endobj 3 0 obj <> endobj 6 0 obj <>/Font<>/ProcSet[/PDF/Text]>>/TrimBox[0.0 0.0 425.197 283.465]/Type/Page>> endobj 7 0 obj <>stream HlM wddId@*ÀmD,K}^._?ӟZ9WG?W㪻'㏏}xYm]#t?.1jzo˷#=Gm6U]GVxjWq]s{ml?Z+zŹWW8"2.}Ա΢/X*768c>W:pޥۄ;V^Eb1Ч#⚜ЈmE-J_2 GN{Vb&˘ڏkg|W+A<D*1|/Nj]8fܛWy׻LY7/ `I^ݫa\|/eԦyGx>rc lh3?*Z7Q ]eku׏SY7W?_j:ڢlUnN{G{T[ZxL  [;^];ZiiY)= drM^g^UC71PJ5BH8ƈ-n܋fu۲i3NFۯzW$nΙ4O&fƣjޖuE;liP ϫqd$ 1Zh}yQ9#-MQcN Ӻy)6H҆6D85}Ux*tO'nB][,uf!;$PmX5-ӛlqT .zgU0s.S99oble8[K.济a?ItlaB9cЏd2&Md?ULJ[a,&lOzUk3VyTU#Ae5?z=tZ=vn%T|+NvX\X# &i" Jr 'øZVNh^ jq #]CM)aMM)4vjDt2MCd44AcԄȄo%AczƘ +SM{<parf*sTikmM /] ۆA]@3 mwqFca-k2hi& )dnk fhM*ed1RĦ#ѶŴ!P~-׃|R,m?(bA;3AB+A7iR)(Ѥi*Ԟu B!`DiPF ~LsGhÐ <8 4Mf7Æφ5H y%f+88J;7ռ[2r!5g 2DE|,C81A>jNY&j"x1]S6A4'@C_v1wi12ۈ4š"t/tZ+::oFLr\4pZ:EG%Jz]I_u"8Ǥr y?DYd4M3|:xʢ6pTf m 4h4 -G>\tWwvgfiz1@ mliRS6D1k ]Mk聆B æ:}]îCdm0D7jͽ  CG&7&DH$PTR)~q3-@PkiqǬ~dSL@C#_=ro!I31R<E1D$ H~&ג~by~?%ˍsAi#.,WWQOt@ՠ(,&?£=tһH-JQa7H!wf;;F9Ԉx jS`DJI]>Dk,X|>t|X>ˇe͇>T|wƗ}d"w2-}X!}X郿Ƀჽ)ԫ4Շ^vToF B׉KǓk'+*J#fX3IDg<Aq[::y/r7Ȕ/̣oMwCŽ!xGcQ/?v7?ƿƍE{DPA[>f_^ܘtnU?37柨w^Xr񕚊zyubޝX_NREhYߗ_[Ǎ%3uo'oyI7tȺ6[e"K&j/hm^.KS#2X zD郈o 5J{qʩ5;QDC:k軂Wz(-w?[?Fa7?֧~T#x덾 5~-TjU8 cGՆ~ozaF[NdlxƂ0"gjDHj7,i s{ؠ(*BH {aJyz)ڟ)nQ<4yh +ydhVc* $qe4P [2UiAֈ"f3yu ; *Q;ŕ> )9JZ_ :H uρHj2U֦%-ٯ$ {|5I<2%mls}fiG,>x䝔ǖʒ[^Uj"B^:2OC=0C)W( 'UdnX'W.ZIJUW¥7)iYl _s5WNvF]T,ckt[S@kCy"z9DuϺl>5|$t7(-YQXS(3f`t%pTd #BKY[ڼYjXSxW-z3s}SqzeBXU;wӚ [y6k@aO/xU5CnjSyLz>%)sI[?,2d9# Jy֡+V ӕ*x8Jz3!5Vͯ&+٧scO%R.[#1\dpQM #}~`p6WulJϊzZ;tR;9v{5,k/DBm[#h0uc$ 'U(QWk29OkDH$X}=n>}=wzѓ2bvЊ2B"Rf{uJŽ[ %EM[\VĢTkYX妻yS7棤R}Kowb~8=K:W]z8tԙuIyDչNl˪ϠJl 0`K8!SL9*çh !bط3혊E+f 5UsՐ,s!R[Unlۑ %M'!+3tsTKK7G#x&wX9@hkOpɓQB(z7+QOz{Yԍ^jmWl D1ձ*k{!{Yܸ˾l#Hň 2Z%Im>F"OM [%<=A5IaƜyX@ԓiUYDˢ#θ8:e"tOѯ Yfjإm>AdڙNId8 Bm3©G^ךIgģ o&ipHs_aVriwlFw?zΦ'޵esKɳf5ΜODY}/-6ptJB~ʟ# qM1zUAEC墇HS*G;14<\R/6Q͕fI& 5sHk9CVbs[3uQ!_ 9f?yH*A)vC\%Nbرz$=c2H 8B0kZhA0!g_d&6SeYI{%%ZO7y*oSɄ:tn+T^̇)֍tr|G/ YU~tfd0f$rW $<F|OjLf4E<2DlaGZ D*uұ4;+ &ѫ%ի>ٰ\]]2Ȁ9HUNq9T$ Sv drioX"Sw,ج&8к.؃qlR Q38Pi>6/ak^b3mN] Ӎ4~l2bLrzt?&1#hQ64, ;Kw*fk4)'%Fp?#;[X@FxmV멪G+z ?Z L[+Z߀tcCSHB]+.mq, /l=:R,E'5OiE<^c\(ﺞRYm?/K3DU?x xx3 qPr5qɦ=x6@ 7\Mҁ?ǔfSvܞ0Nφ(7(fN݃ƿHaO=.qNKn&<ƹ Ә_SFD{.d+%͔l)%3ł vyn: oOad#ۄmV(]UaԜz=V|ffN۾qQ)w)Iﴝ[ByU(k"=cLby`Fy9t5J\c&q,W= iF|6nOj^jOM [n >-^EWX PJAzǂ?[YM#7Pf1-ɏf_Sg.7%-cTq鷻?y*@z9MQ庤& (2MdTRcd i.[%s̙_&SM9].U@] %@ v-%,9}4{ɲaHbv'1 dRYYW.JaW &oӁns]H җn)ήqVcJW~~F1">fX-*"t|!QFvG@ԕq@ow+_ݭ(EyAVNga}!FIoF !^:Ƶ8{_˶\}HtQ剫bK&O4=t#YUR 2O0j]qPgt֎;}1?u3e%!vP7ǜk=u̖oTM^FqSot|=_S`&H @&fX/ NÛqjWͮyz*.)앵 X)1~62)Gjn3;mwjdpfly:BHeȣ L<[.2_-sŦ wG/FL>oƄg32zadvƅPqSWK*QPΔ!? 8šB`h^R[05j;Ԙ|9.CL#<}}`I͆ N@֏Z{7zmY'p-r "dy-#f=ɚkzZye)wOۑX;?= ^DSu@zN*Trjks߈x4D7>XS?!ÍR(DS):Uhd Zjm,γ5dЧsfr~$slKF)ky_8 {V̓PqNy7$|YJm}I4XY<`\`^oB~k҂cuTZu2^v!-- $5-Y畲>&ۿkZ%|SeɑJVG ځhM*gqv V|dq'?cƎ娚# ֪};0Zq]$3R<"xa0 =} Fвo6CAm񾦳j f(\~,7aI^*6"zؑBNs #mOwM$Wx ORkJ;ZCi:~/ԭ˦xO܄yF䰬XgshbDVmb@V2+(\f]M;:=Wln`M˓|AkNsլs%dŹYQ-;T ;da cgߝM&9gZ69[ V@fJ6uLcKpl>:QǸEڲ|_)si-3 mܲotHt1)c8uMe:g^,'K (8BLOL|4_ }s6ޥ3VE'R}ztetP2(v[J5sz]&;л`UgRiu[JHmzMlVx}OcvCCI&΍EQѥU&|zӖ}^Wu.e \>w͡r@B4]0PC8c֕k~~^q׀Iii9| I2 ŧ=69ζ* J&%|S-r`);.==Vx-tփ$ݑBq&VE9zz:ܬNJ}tRU':U@B{<>vW |_Ygdg'W %<鰰is8ũWQ$2D~_r% 7+T0k2_h~ lsE x8\`e@RL ;;&wDi hX'aoFx|ˎY@ 1.Pg%|w2:,ďW(_{Sgy77¬98М`.Gf`4*cw8*CE_RstKmf.zs[X4Ʋ,󩂱oă.iqpiбҊN{6R{l$C()Scʍp1IgN[,_{ܞs9b{&I;P ξ[ Ïs s.dʅ5%'y0N s>H{Щ1g-`lbL-d`65>j¼UsiZfMcp!:d)5U\e #06RŸR pV;6BLvr"RZAar(O6[AGFމ5 WIv+7 8y/g/BTMvKsU']v=T;hؠlUP=ۭ&PI=p?ĪU%&'/LrK_>IkK7Vgs]էPO R& \D%N`9%/gQ^fv"W>PbnCqTYA)cYP\>rc m$V R+!F9 )C@[d̸xǩFJ2^P4R6nZmD5! GH)DKΔC[`,SA9nB]^1[>r7$X _LHrL[#V3Y3ٸ#W}G:0E&I#PۆC<РLDg,1 dŜI1Bᐡ)ժI rfX]`@,V`$$g~6zu'&\)'JxS@(а$ؚ<:Ԛ`JԵ 1E] +U3,t ŀ/GMLKtM]<`:Bunm*2o Jeԃ]"7(:Ia?f#64jQmq<=~H)90eoQq#!9\ܟhaaLG/|~yҫX B>'Fz'dd$vLѿc(NO~Sq?=`h@Qi3CT?^Zjyb|%-=y?7 e _ٓ=͞g ' -'d.m=;&ۗ[zoffS`93aZov_8l{c&{mZ^gJq'`Z.t/n_FG5kLo1pzr x?ׄ&[ \I!Z|XZlf_|Ba@VzV vYPר5V U(Jmg;!Cŵ '?5>q+i-|dvj#MQCE;1EdT4%ɲ,>eneFiY:U1"ܩI ߊ A3nTzfϣƶI#ɋv_aؘLg24r1i> NnO UPQ4/P^)8?| K!kuL$V:ʑXI^y&5fR]I'ޓP: y3]O'Ʉ3:8 Vb|G+U[^dI[F)DKJ:JK|薏7LH7O{Ol3Ozx#g$sRVN 3O+*AJ'=%ezROyHnS?Dw.U__R9r/T|J\JVKvͩʑ׭п/= ]򻤨cīW~̞+NMnQ;y(+04n҆[B6!'iiKhknW TK} '(YJ=˫ *-yqTWuڶѫמ +ZN'ODIDsP{T(ܢ|tWG=zz(|Y%t Ty*W^6~*/VBӚפW9Td!qL_j8 >>nlo|l>ocQESCgѻ^V}%56F^(~{ݠ7.BǴ*WӯKBeK@|?|Vѫ'B[y}зR쾽Y1>늝!~/m_X҈ҳ+Uc6=)]>rY(úcrm@!>dDkyPT帚m)לؽ^N%0.i $a!r#B;"+'M]J& T'eN2!k I#Ii@+QAh,,$(Ly7@Z.k簙%UH}O}Sq즂|3'̅tFx?/o_R7aVLIp'JIEBtqKռ\gE.H.6\#Oy|> 3T f2Ȍq+fWYŲ}ZVOi.[MRhEщk>iT2=egbv&ONA}8&q^*_Ȓv3m>ry֣ѷֹy:1o\I\ּDNoWDY.d=n3V12q]t>,BAI R{^+?]5B1{Z|jTBmɽ~ls)bpʴH/xZ^npXޫ].+41lcT7|:ܟZ[~ቊbSi,RPSilS6s'=kW?#8V֞4Ÿ%Ul%4UZ"Yr?{ޛ~]1(74U&Ӽ_.!+OVru?n}89[h {\;k\љbO60tcYGkHWt#O#QFػjH/U 24lzc:)).~i:?Mu㸘CevT4 :Z ܕ^s @Op Y? B)̛wk"lU&ET~@7(+B'HPXueҜ$x-S-G:1\ܐHQI"`3evI+ =f寬ktĨ耏vxCT$p&ʼ @'I_^[3x6YQXUﲒ gPIoG:a%Ha.D=]q.%vFZ\lEl .( x9bYDoJv}o/]f-f$ѯ:pP#8g-#Hv-|fTNYR%m3{U:bߛ3n"{bp)*9|5Rް`ehB@>yy7" O;[A yck 0ͤ'.IWĥ}N#<;#q3&A$6&.D%/`6hFb+(q%N'( Ox#kʏٶ&d3 Ti [.PAQyG<O9xœ^=)k[WoێFCi3:l7lVS9zZ-I{WC/fˀnvw5ڝݪtLJ@dvw4A6}k0;nZ/j-YִԲhv]W5b.Zmb̷&F>'9>U,i%zm;}Onk>btʜ1gȡa .(VyZ79Tpkp;Ǻ[aeLǙ)nLvHchssBIq5=㴟ی&:K۞h#{|:uHKS[#Ky[`eHX،NC2#Y cDR^)HHl˅$Uo,OLE!E=Z3.u$zsGsmI69i臣0x-8 lQڇ;׸k\3K3 xO7_o& ijK]5|>|z'{F0ėcVL#Ri hm+8(fJuz vX;Ar<e*QwBbh4PDScH#EEeˇqNت_nv q[`"jZoqb&o㺭,$> IMk̽,LNaWkRe1l8< ƤwҰPtE`?0UAqĭ8=rWa6k M78f~4!;R̼^IZ8"pi4 ZCϒ,xiJz84Ol3>/^!Xwɚx{їr"N=&%g3$,Zت5[ P% XoohYj%I<\1o%'B¡ǚ::{N}xmI;}bڴcj@"\K30@l;-w^o< 6;$] $%\X;H/.q;( TS(?39+\x0#_xf[ofaÚUG4&"Ec|gJh{총W6[? J=v2q f <2x!z!"JJOhrŒ =o!.B?gwװff 79 6)W9K$e^s֬Y#7L{!P+Т|󭺽`b9qQ^QMRv}#^1n/FDB "")ժ$t1!DR;7comvgAQ67e2vb1-bV$ b @p{8]J~(m_uו.) _< $ie U_f$|)t*\N$mCry]N[8u9?hb JR )0H{$/e_v$ u{lBvXO ,|dE`\2f-uӰ`6\٬p j lf1|8X`'OW;hy>#o0Zi5S00BCP .}:uN;QKf3zu^1-(oޚ7a4⏅2܎ CI =j Ep;2 6&-ݑXJY E$z z, D{n V>15312:Fwl+x"6h70dcD(J <0`hT궇pnxe;`llQ_4sA~7Hs3_^bsx{ԎGO:,Tlj@U?Ւc9n} ]Jy`T_I*ѯ$eD~#1Kz#e>Ԏ\ḛ:n[% zɶ6@P)l0v1RM&?U6.JOCQ\5ܚu?3f%1|UzBH/k_18m=Yxx @17(0bC ߄]d8с =K|F0F}W\Y|͊"zv-FXQ$v&:.t/Rj~XFĠձCM/֫DXw[tlD~963Ƿp_mqMX^>L]|67EDn|Ȼ>;:~҃n'* +D۪I"*$TQ7LhvWg `A>`^^@`VťUw ]XnE^?yCѝDtgB0h;_[Hdg. sȼԬ jx {$@5/**\Cz~𞅌RVgôwѺao@rG㭣B0I:P@L`3qN /}'8H/n0Hl/H"0mGv@X8@Ih_q؄ :#l¤ HnKPjN!FK!}q|*ԩñ 5Pm:'!HZSHj X zKr@1=P/BZ=Y(N^JPBSJYA!-}&Uź|Ek&oR[[ go8B:=!!`` y-1A_3X4} _:}H$Y =h:1@8&_T!zm9_]˱b(%\#`ܭ!,='K$  m* ò]KǗHЦC>Q0Ͽ:$pH!ْF;0el˭΄P0#0[!JVPeOq[Ǒ̪hkΟ*|3GH|ӏhvMj; :N%޺$X`ش654U7?zV #&%!4nv91T=Him9:ڱj |,a8'1~αa}OcfJ "fd΋y d7h0ff}U3sǾXkجm.1w$ga~űDA;-r#8} QR &ŮZC&cNvPw;h&ξɰ wzA[;/L@Ds묺y:X ƿ>7?3_>1j\tF1[rIpC-ϏO7ᏸr_~(7鞼{kR?ws[G[7!ұ́y`-R'm5}_M{G/62Gك!:;~6!?.׭叹8/ƹLn}HK&yr/ܧ[!h]+wyaߧ<4cvs,!G;!>fv1u]}r: j$>!Vi$ s[SĴc֗-)8 C~O15g]dKwoc>1:wR9 ]cnQ )܌N0Ĵr˾$-z>*쓉s58 e}:y% tR$dfA'asνcy\Lꗑ;t=.X,K%y)nj?;x l+,hn ?Y{5 r;J<}owi||({bsA#i:fSK;hydHrUs]0}b҇ ]^7i7&8fģ|koGBKX$z "zf-ṽi)J+&.6IZFcLY|Y׎VEJ{y^\eZ򵩭KRHk_\ӽcs|B o8xZp57>NIZ%W?! -zt9iH=d p/?7T W; :*~/_:M-K1 rd1"n'O4sC mYQb 2ޭlЉ|%3~o.W}93kU*Dh8bAuvz?7M;luSӪ%VAY*gB/Ao]:I; uNAX|s$~!42~IPMOFY|:R]S֖T^bek6#A}3^ Ǜy.U&(/ D& ! uz][۬ Ӿ7)AI5? Ŀ5ڸW?ujXC^ոX'kNwzPg{.-/y?zjz謃rΥ6lq;+6D5NQMSTg*Joq"D&2r\6d?A[ #LvRS1}3絴 i.qqDmP8&p,~E#: d90 ı}U*Ȩ`oUUŸq Tol054tk fA icq@5QnzkEw8bh~ [{o`d" K Cwj_MCPI:k 'b>)^0l]O\\K`m[ˍƾr'XJg,Aمqo@nTzTWx| Fsel3 J_zsAwbeױ#R=R:p/J$녯&X\S,"\8>.촸ze09'yM$&2K#? $';'p 8;,x͆FD2P&J`7K99jO1ƓRwe:Mc`DQMIHwftoOjzkHq)@m?l/.N}{t_5?{"gџ岛\Io+ٯZ(* cV I*3f&FO١nޫs^ɩ޼*+1?\'\UG0\lPxRY\fT.FՋd./wݳjII1xqNY4O#H?T0#jb`'3Z,f8Z7u?Wa5d!k!-cȪN#(>3ADQWwe*4=ƅ:14X1;*jUY+ֵr~qir7% C!0&&*{*֬8LYOϧ%:^ǚQx@߮yvd!cMAxEr-*@Nf`g۫ m}os {Z'lLET#)&rq9PEޞ:#o[mrt^C;%&aȅ{'{.tO&⯥MmG<"31~ڇH6b,/v>CS=n1邒҂IHz%ZKsւNnb]~.'v+&d>Uwe3_HF_ A,[W\ =ͪ0(:4gªfw &ʄKFTI0p\|.$|XYpN|fa9bvKn5G7WVA>H:r;8$1a?0JGZ7Rͳ͹ Z},`gFT:†#uS$s.,h_/@Xo`T9 #.詎!@FHنLu >w_٤N9bO0vfo=oU?F u;N_ZZPhY6tK,m}Vjb1סj('D#6hx\i:&Z>ѩgZR(kcǣXݐĺtL/ɇ'Sŋ.mȨ? uY:g8;Z1 +EHH_vJnWX}R %qUnO*V (O+*Gq#: U:ü{uF]bYEGP }h5000ca*Ç`Q_γB|Z6s UEАHJ<~ P 8ʜW:Kx01 S`VA(4 sat-9$ AN9Mat@Xѽmb?psdn`ڏ`|Q%ǩzԼ`Zbߙi\Vt[1ac hR]ͯ~i0jSy8*>Gwkh_SVfNӛZ 臉UC\V2g-PzVFؐ,ɧ:̓)3?lAJ'e0ɤ>{G_!&쒘<3m#$y"DhAS!*eL4K9@d\oT\DztrQa}ҏLHRS%ݙrgU =VbŒվ'WGloKb/cbdӇ@$^Eձ8zH(m>[;4.^1!.ʃGh;N立3w߆=SX%'*?d7fipӘ&>\M+[)\?;8lԏJ6!hkUDd8eG@v݈̍ݟZU4f)wReFޗٚ@}xswTe)EjEx_Yf .+QW߼IWfH] ]ДdĕqJ#ԬqkQ21-_<ַ oF҃k/ctߏ'X3Iњ J.aw*cGhi*VnP]w}zw^\I(N3i6t_)OhL汳x؛Jдu౼j7u_C؊ :0WxV355б0։^~؉k?w JZ03ߋs V[ώIuKQ#rʚڶUG6|S% ^E\PI ͅB>Lu210ց_}YmvWDd_<}2GLQjÈcZdctprjA18^EY\UW&s=q*SFB}?8~LS95a*)LJe8xM zlOٙ#U.k"~&|Д+G NbVU#WxH8kXG|wpf‡̛7`Bi<}o17+PQ5 z5El Q_L4pQQmy=1=3i/&QC^Pz쩠ֹ̞v8pa/ma"JXY_CڍKvyfng엫dщPk`eT5 j<jYY*&\L}D@8^˙͟x&;l(:!ƎҌyFuj'i ecfh: V鵯˶ѿ_P%]$!`"iFI-Ԫj₊Dz>hmQLd+F#NnMDiJptCBk";Ϝ=ԳR'5':MSOc3X>ǩkkQR@@X .} я<>@[UmP ͹KF*\c:-۲,fp闝>mL`do>ͨp=MkW.JvݔvH5_<*f Yf2<q:5]ht"xmWG#?V&w׮hYḅ" 41O9l8e:RGJX0g )):2Kc;듉<DPg16f k ٛT $syBN%eҞVm0 rFs@H!!N.\6 S)8g<|h̆-ݢ\QU&jؘODDaMpqA/OU]gƬ60"֔.EޱaP=D8Qt%lţ+6dV]AMB[,*3D%P~]LB=$X]^ x  H-evL6̲ǬYmE,hCC#OPLЭZ -CR|nbL.Va;UFS.ym^c o7_#9S C T- {}G"0ơ(V)6!-+ &8ko|yK_.b}}ڹ;4#H$=wx2 #YʐQ3ik:J@g:*@hՒkD۝jif bx -+$,&}ˌŝ9ҜzsVk[e'GO!%Jm1Wdu`o w?UPU2m%rЖVܤV;.sֲ6 ɡQ;w1W72'#rTv˩~:1 vd,yzo7jD!rêhr6t^Zeo!tn/9?|ݓyfJۡ$++>Aٺs+'mӲl:09i_\:;R*DU)> u kGmzڥ8v]dX=63kj3--^kv38S[G鑑ݓ}`IA }2zCj֚ ^^dH͐'7B^ރЭ?KeoRuq]F!k?F<Y:j Rpu =R /J5C(2DQ$1>Ú#a \QrjwZm\ -'0I&JQ}BA ڡCZ.מnְ)PxYNU̪K\KR3$l0Z$Q5YHfՃ%|1lF M@ͮdgԿn0nkhyNbƇB7 n}8Sڿӕ ~}g!O *dN<9hwPp8k{Ρ9d-Z:7j.h-T2aTV½?57ZǵΨ:Lѹ;&FsxpUpd*hĔ[Ό51J`,1 RHhqwy=vSohֹGTObXe0vw961Nݼn3(ݛ(j/|7_F˅/HWe*\]\ŧou8]m/8Kd7XZBbI_uM\Nk3lJR'U42aX.69 ol5^'|ݹPcZȕ~N oR7l`~IiGW} 8/ T\۪gYLXJlcW On v$%\$JrL1's&U rM3USOpp]S H W;fC()Oh5Y߶y $0 A3xF '8qY!nAmp:궕_6\"^7+w˷+X_15 0~$ZqԷ&kd]sa]rY~-5VXEGe}z.aw_Bo!ATA]v1٬-\8S >.\Ɇs =ef=ZO\fZR(єs=CUABzTC:RzmJǕhaK5sk}.3z;vG=X̀b$36ی;}Ԍ:Ł8Xā4 01G (@k%Bҵ5Ȗ78Z+gҞ5 턉?T }?KOۗxGrua3fKPDr=D}IiUOWx&~'|w<cx9Ξy4)A稭~GW IHh4GG3# 96 \^ɭܦ]CQ|U w /̜Ⴥ+KQ|Yu{^EܵZmWt3gʁBc"\'~5-nHIW CE(JS* QDvIg;yܗ S,UDA"}l):B"&O>V|H׍ JR`@Ѽ$KO7Ɍەy)-sHT,'L§HQIvHĄD2B4觪;A*Ja^%5KgHg$%W}hoSȏ7P{(%JDR9\$J҂Vm,Q `>ن@cGjy[uvd`"?RRR :$.HP$kXbJPi^(>NezR&m)?)QFI!I ӓ N܅Tt^&ۈN揀dYJw]p$35]i@tUR **皹uO\'uK,ǹT7_?emS7ɬQNեֱun|GFEw+^ٶ8kg5vۃZC]Jn,+Sp E{rVzFг&YOa 7l W¤89ԁf 4fXPxĻnt) S:sqvڗq䜣[GVu189Wީ@{Ƙ/| Zޖ7V4mH83ku,?wM½0 g\ h+o4xM.K&祸ى4(h/~ d@]x1 CBP#C!P_S죋hϸ& !(٧xav4!=oEKC* K$&_*$qh-lVm6~\RFF C3y 挘5=6 jAT .։ĥ"e*rʼىD3 q6zqr\;񵻌5'=yO6:oʺmc[hYC np'UDU x)Z@z򂪇6ħtW&7աw= 9~| -ky*b0"JxL!ssFogU4#](\Wb%O0%A4jlAx._Lj׀mYl8q0םf ocV\Y stbfI< )A>N~M ?-Ǚ!a!FYBhxĶ̓9w#+f|7. k }<M &msmm,&@xJ8B,? 2q"sM9n-T-*>FUM-v#"GPysE)b_B9*m i< HP[F{<$&A4G &zьFŲ0Lj/fUDl)HdFL9D%pƎBҿWI9+6/uRAF*R7 TT,$EN Lxx 9M2c'&AYT3yx{a/qĠcyfnIR@o_L>uilzPF3V,sIA]/%SZX +SH ^E4: 'S/ ֵυE$})u^Py>gҺG N} u4*]l],ـ&Os}ʦmr@}(ׯصrݹqHΤ?SKQ&Re}.ɃI[ pu\%ǎ쭥j qq\|~LNH~:c90(K[(u͖OJ YJlF j]tF뺻ݓxO$/V8d~(:8^>Q#z,SxqsyUw!1=C1fGLg ,/ 9:ѣn)ӿ?S=~=_iB:J{k2/kY T=m79В_2 !.tj'qi*SlK +mQc WZ Zlc#li aqJٮ/ف 9ʷf'^(c=-mεc72rte°#Sқmd4aW[z'G7() d!څ6x_=25;oVHf"wʩ8exҼ I 4 1-,'H 3bo93-?3Hl:\ۚ(S8<¤PwtcN$BE245E  8H 6W`Sa? )Uv&YjcPj ȷrԤ+h@̀@aj8+'x\KLm \6,h5gAⱛ$< ^M` t򧅡Jo4nszk,Qi'Y%7KuYHgaEP/T.kKu^ZAK‘PVD>yB.q@!pFseQ0Ih +*6n;H'fWT[sxWzHN\ֆfJ-xz}H)Edʳ+'#U{nZ /?`ETQ3FX U>pa| zϔ3O9@_. txa.-{Y/l@ 4̫Od=!zϔtYȺ0J Wb2FTMt?9@76 a H+E1Ԓ݈p-8wnS0J+zVR#xvSxyUZ #,($dc⒈Ϋ|ɥ\0)m5&B'Gy'!-Dqp+M:f9F^j+fQel~G\&%:8+[997y v}X6 %^h? TtŔ.qPDx1OF<.cUp3LC:~YG~(ZUo `0|'TZ@kz3HgJO*H'P:88}$ )- &Yx J󲡮8{I4ӀhwQ (C&8>_<a\I{/pO݀#P}rdYmdX>pê@/>8 6'"< ?u"j%-5= KTqi2恪JwPk*:s|4- ǭQw|+*Y}TNKs-cv2eNE/y[X}'S*a 9/' udڮZtaNU4ڦEyB0]XHFo-:Y)\ʸ|~ W9I_A}|K4.1ce ] y3%\(bY'_,h0TvE pSZ89U2/CeҢwJڤ-tFrРH+-]"); aH6@Eљmr׬nɭRlz֞^T-|(\u!=nmT K` X-!^Rvx=ɷ|8ī?S7,?d0L{4Dv3GT=ۤ Չ9ö[mi12N|-To̍bzS @(Ơݗ5vjApV.%^yWWs9JbP ٖ⭆$|ɒ"*SU%CKByJ|Z?SIfs /D c^1Ǹ7"|MtwgAKd=dD>=5v4y͙vtԸ-rfV#׫V o٥]n}8E!w@ BK ҫriG!ss=HW#Y3 @ ǹ"@352K~lhH!4phBڼX0}\ݬTi5װmAa{:h68b\K DfhjJv'OT ~qbtFB Ǟýd;3Cw0'9Un$GkHCG܆EB쁪G[xօC|ny<2yu ,.^8b,)^秗jdW'CKMGAbdD珵(`,nO!lٖ&h$Y!rxli9ՏlmGn3dΓ Չ+)q<30Ix,󄰈)m6(f eYK@$ar}#ݜH:%fMZjF:fcCjk7!)ÿc+ >׍o1tLQ,Soe|.(KyH|J9O4ӂ٢,iC [G!@&O7{52V[G0+Jj.L[), ,, yD~YҞd$il(ǟ`ɧK!:Q:mg(XJ,3a쳐㶫7t>pʢsWBHif$O^oa!bvM x¹7}d͟y$Xncqy^dWωMyzy;L1}:6I0KipO,/WϊuaͣpF=:?7`dſ^]BYl~\a1 &k @sF3ݒ qwC<; RpO֘.S dVMwgBSE6ɚgA8[?8ϫ!Mm$ն<|sݙ;'n0HYY)qd$X2 idYޱd udtmBoMw+Z1Zl\5bmK.65qLK3D(Dg_}.T=`BPP$mg~Ʒ2{\h&g6J.\%1\(Z?ZT[<],B+}ך:tT)Ay[gDg4X|f(n!8V^P)/TO_GsMFC¹BDy~T1̈XgW;2AyCyܷ23fQ1=G NypfMO*N=w_/ EJəvTtpL[N߳#X4A?`XbyhtDv=v(F4锺9>Ac@\^lVzΌJ_X0el@/o.9 =hǴKbM4~e<# rgN*'Qī( )pA(|aRp)W7MNegdˇDwrcx:l5GM0kI&[hilnmN߭mn?tYK%wq/g .ZI|͌h6=FKUcnt8\Q2韑{C9vPr]h{+?׎cs5ܱ|'&9㻹HacJnsx:Jm]rWj%f ⻵@HbL\M av9EE| KeIKs4瘻=/&\Xdj2 s s\-igOUr z?V;sR;GxNoK &B$WC\UdEWBH&%e*G> _Ց˽-m . &WJ6~ŵn _ ?=dڐ-)T 2m Q$iARD\F0_k"}(z}_XSyM1 ;\Y]ttOKyA|*,+O^k^6@ZuMe3ao0nkU$ZLK#;Ó=dVEo0ajF̉ 'G< r%g#?X?&Q(u8ёK@rbY2c'&D< 6Yzy}ljBƒ)"K+zDJ=ir lP,dj+A47\{هT B7jɶky-bWZ/ƫ q8}I&HNPkh{ۓS^)t*ɴ5Tܓyii"@3}sWzZgdi hu42S:q 㜛"=3nHs F)%'-֪DmcUqяGXbuYӟQBd*W;ks%<+Qi!A EEϮ2F #@-t}0` [RK_҄ګ5ؚ49oǨ`WV exc2yC9"u h,X3\"^Nd@ȍwTca-[ FdؙSnwVbX ֚ iWvcMLbz@b#XF1nQR`RlL*;Q"N$ғF20}Ҕ R@D5XJEڭSβ{W$_&ѦM8L{~SPȷܖT2Ic X3гzC^ΰts^uu]O h"y73Qݘk/[,aZc55a,lDi,r2nbΜxIôባrg>ߙ%nA~Wa++Zc1MG\ʂ )`|7*X¶ECb S u9$$uewTA,!B@ 21}pRoz Ҵg$ D\!XAײ$*qwJ\W8l~+_x\x\T/O2lqx@낒d~yZG@yoctu;:~LpxGJM:ȓ Ojp_" m0"?M2rnJ>&G.qڅXozTQHkꞦϾ8y?a o<R(39V9f^JQbj=fATzYiPȇԨ7ą:DgA~h"uƎkGM? Xg3u tCqӇL~Q!>/v[<$kGhHSLEYcfA_IrSr%*60׾vS&F$9.-?ƛwQ"^ gRS-bK]B{^-r^fD)Z=zJT#j>'o&K0K:]z v$$Z{+{,2gD{¼zn%Q%/{% Z ׹-T 󱷾-NGv4ydI}"/P8S<P/-" b"K!X\nby77ratdlQ0e 6m1+F%8sR!} 'Y2o㡨р5Iw٪}(VBmbQmYU2 ݶxZԭ{jۇtK'[9huLI cfX[60EGaᏗӟSp!*zAh XA T E@Cy in [b&@TEI$1Pa=qdq0Δ|터4v[>X|*}m EG0͢`Pu0lcF12vj2У.r.5B1r;MLi(H2_ L<h JEC" @G]~|Dwߎm" u!>EՠG4J]Fōl]{*]UAT]V[>oQ/'t_! SO%߈naBiDmilۭyL%-nXAX --7kt"bhQ}E'(s j?(߮MDc]R&VwVnofӍ""5 AT* @sS sqraZ%-h͚=qs^;~Ƴ.Z=BexV+Zŷգ)X) *aQ e.li}qzdOo:@O(χ?VCp5>r)g#w/J'ii2ޚN"F쬼a y!P$z~GYKJ}/??_j'5}TCqɄ B[7TsNgb^œeN<=K5iVSNMe+EDw<>]YVK&Yn`ڪMFضs~͊GO3&%#D~'"tjΛ'{41v]ϲGy.{['*=nޟJSJeno~z_BFGَX]پP_;Ԧh5Q*hM9B~UIfFB3CwWW01,l9-8ikyUy3bncA~z1ݟj%jQt ҨDkը<_ӧkp4ȏM\Sg9ahYp +c;H6 *d"Ү9:5ѻǕp@҃Tm/zpI)`b¤c^PC.`huY ӭ6 V<v4_&"iF.:~Td2a$\ \`9^o~:⣼]◾wﻼT)q7̀iy^ShgmPِj.7O%hQʈ|k*YOї0ɝPY;|tKM{6qq옋y@;Ăs~5n+íjxn@(DPU؝|i)X YYļV6[R)wd{|]{N Y )<(tF\0Q*ԡ^&e@-D"҂5?#8-J$[%Q3[$swßηl/).M :\<<$pSүF7\O7<ŏ'1"?)CL fݯAܿ~}1FbD䣝B_ ،p#@ XAD*>c_!u9/>ݧk7bBhp se@(ٻN .BԒ랣SzwPMiNlak17qRX3p1rJȸb%%U=_*T 9tϹiu6;VY%^V*v#6K 7ns5$UZ)BE "0v%z2宒iJMI.̑"6YH\?ױ{ig~WɕK)9.^LyN(UӏvDMo/`S=Y\"?ڐĆ6&#3"bzGā#.yk$(*qSK0k {DD3q6Z ?WK8)5K'db %̮ij²D$*0|6ttza[beǟ&ӵs18(#>"e^S1'BPUeuԵ}g&k୨',lպ{k4lnm h@` 8u5$tҪGL>!{X1S>*{F0UL+O{w9ұ,Du9mcLЇvAv C~PW ~Iݽ/6B 0cp'`n ^'O DCh6;[t o!؍ack`Z24-8"h߰m#dskU"PW>c_5$+ɦhh)3vf,ʬdjMgS,j>V,A26x# kWd$>c_)Q"dd CkeqMݼ#wFfM2%`ՊEщͰDԕZJMj)%,fB+麌IY>wC=Q\zi;9NˏNʓ4a)^C2gCF/>Y~쬋g/WR\؁i3#S9 >]AzdYSdo-W믓H1'-|XƓ6bcԘ kosxlG`L\6\x2_?>hكr;ijtAyCZ@9grg暎bS"2NcS8]f N Gn;?C=/ǒis*ZGrf ˜yo  -Cl~.9~`1E(Їy_{{6i7fÇHҘv̖XtE"2Cm" -3L}OFNid) шMɟCG Xkf: U>QZX D]zб{ġ/L@HШG ,560#_׻BZ-\] nY_!zf> bȠ0t4gqKZhxD#M*ǻ,~wx }oBe_/S}“8&xz?F".$SK@q[TSzӦ\e5o~k?O.6b/=w;İ 򂽡gvNc'ijwvX%YAbs7;0 s$ ـy'dYv#3?A߃P=&J2C?Jҁˌn(Zh-Ckh3,GHryWGBϐD/OKHeKXd;7uzjW?xAwz9a &;4:!9|o iʇ(IlqpIҭKpԋq$BrJ %> DolXg=Q9w!^1$<-EZIQY,bۡ6iZ0exBadk}; ~hX j>sʓuKg> 7H;CΦ4C!&Ünm12Bp:I ]rՇ}\Eqt?A/b xXοiPw=|AQ?F_$\sOxW\P_JLvްN'YGU Hy>Ě6!ӫpǂ)Dah[b!Vh89'uEK S &h|_{pdBU!/\a4wSCdk"pCHxax33 2Ģ) 'f&|ݧN=|6z fǁ鐝 6=mQ_^^ûf@0R˩cDU m$Lpyz liWpAF &a6r}gUVc'b3Z֌S}#B9Σ5W40i%4cʹE`QM9ԥh,(>t^y^ǖpJHrI-hk*S($n|#"/z+? k9ټ8)z}{M9}1-`޻nՂFc/ߗk^}\LYG'˺>Lg$и"ۓ>nGrGW3s}T}:gJF/FtSa_ԐQtb yPdĴ㥨4]FjbvXw)p!w'Oea.HEN|Hb[?Ur%;eE:Pd ק)?@R|Brm VWi_Q4Vӓ< F A x&5`) x Z:[(GcxmQsnn);i8uc6Z6\i8IjY>?qkxG$fjMLa?Y4iy9sXLM]._5E0 Oo  EnIŦ3M0 Rw[҄C:Ky!.嬘ooYyɳwSDqv9n(_yc<\DέsNȞh:b#JZC_u"P. v8# A1kZBԍw*0i MHhUݾnFaٸWs#PjRu#Q(Y7FxEB["R&#C ^4cA قܹ1-{|֤x6nw솠)fCo[ˆ&5 #R#k2,@ڴQ%I|9ZLeXy92h%7"4q(h$TbEf*lDBlP^YHP#ф0!piV "1B:nKCc7!dEuTl$Y5K itZ鈯6">~_X8l\XqyV7*3_8/:Xf|) c:0 ~uI,Va݇ ,6>L c=!_?˜TڬlVn;=r^!`g_c ߶-9P@׿Ѩb!j"LL&],Ql Dslӓ/f1W3z^I&h&U xѪúnY%t&{w0s[# [OXz1~b2Q%;Q6ƥ3JEHya>Ch>ѪjTn ͌N(]]IfbRBԭr;&:A7#ۦ} Պ^ͧԉM24fy ht \E(i7=G~%EpѶ!/ibRN.]w-|<9|!7tlR I,Ě!AK:WbVVDpY3R]$FM nCV8nAMt6S0:yq*57d@:Őtg[p ND:D,d$JD!镗 24yIڪEsЋ6p1ur#03ѱ\jz*++v!<ې] BS=Trؘ͐:p#/ =咜vOZq4\2d~cZrh]2of$t:9$^*m]VGώA|\!|G`-9jd/o@/ЉZkGx}$ VR Qנ?h k~=JDF^/ۿKSI柗d5CYIMPq$uiE+4arM-{dDh>Moˋv9z NaiSLWe{xek먢94+|˙gF}܏0Ը.SL;dCnh )Re7"v [Nm kv#2Pb=!m#hg4 @7džb/ |,GU3!KFqcxg#؎IէEJXA[(5}]<70Q *W2`UnX 'HJL8~U# &!A-LUi~x-/\L:2hm(*1ƙޢz'0uD|u{\v(:z9y;SPC)taL=O,x-)ZpSJJ.?,;L5#T[_R|ҩF< I.6Iu?mi2^6z]c:`0e< k:o-laGr*Gxspd=/eر :$S&r$'C󞴧dy3^ Hg1? ",2&mE9{E@iJa.9G6Α)`xeú.Mk˙+6CNdҟ+'y&G#h ]px #{^>dkδ.bE3aT;ϻeϳGǙQV'un"HQ?hxkK%/>)p(ny"kjvL$W 3t\$Wy1Wвȼ#M,_qz?"ŠI 2xG~B# AIW@Vk%RxQuhb)|*kwu 쁎7""~K{jQ0?dxQ2ߎ": #5LWaga3'%-a88 zg8 Y{++2~K!ƊP+t!@@0 ai nAģ|X=n H)!>nEDA$<, 0KB%SBf`^ k#~œWc*%1$_{ z^V^N{؏" < d1\q=7Gyߑ^mQL("; ѝϽ|J?*RxUTK1 Sllد{iTG@7q4M?zf:KP䒃%TME#PVw" rHEcNݸ,Y0}Sb~r]+^vjeYBe>aǼ37^w^.r\/}!.r(*?{ -͟4m9}$Mb)J˲zxŠY1P_ES=ȇc=dJqHݟt $W5CaոˏHV_G%OoJJ8e 'R.@:䂢4cUcvΏ4a6cOr3mn/ ʘzpY\lH`*Wz{Q䰱hq,Mk뮹2rti$Kg gY]ef;Q;hF;N0!&y~M"G|8?+5@*XUk1U!ZY%Nd4OkzmÆmzh ZwqXØmv&Biv?E^@Y&ה AwD*U u&cÈv5vlgHjbL{r"+WSx0-D^,Ҭi”{cqS9nՔnN<8hcV.5CF6:vHV5Uy] ;T##YT:sV>"2ɭG?.Fq&g0腵oU|,>[6ǡr˖#.+z[[._;XC26:V["EϪz`EEoI]_j 4k?$JVQ/;K)}2̮SeѪjqϟ('BgKn׺@Knm*oyTƸ*xw{gn(z4y)t)*+~gZdiGNR3iV9J|7g-uOY/f'oӻ!WڼN)z zwVy+2)HA@çtǤZrJST Y}c$R9.~e$(~IA~lKJQ}t4Kp'!` JK阀JēK蠺q0r$ TSiwk̀Uě@IcZ`GhmsqH3`8GџV6ѝVa<-0@zݏ|iNNX 2]~]~uN j#URbV!!hC D%6r8뉝 *.׍hI!2Aha @`P C5սOVJ|e+lSz⑲i@0HX>6y֜1!Ÿ8 0/wuC/{uaT7;sN ZhP{/>p!\hVsRd`P?Nod_Skp7q*?u~P6#L*ȇAQM%SVL`  zxTEib103BbbZcv4AVZL8MduHP]b){d.}s&k]7=s02[5NAk?,u>e[CyJy (fF0a5} w353ڥR8Y)gA {Alz&Qb@7;1R >Lê =;140gQXܶ7e-SC0CKlמmȚ F_Q]?%ܟCt/]|D듀$P4n/Œ]d[`F}r$FA@ VOHHM)1ֱ?"9& L }t3=,~x`O^V19HĘa+>#[L)T ?u>R_ <ޡ9HPū[AIob!1EXPw/xb^(jnw=ƮA8Lgҩćyr==lo eS9d8)D [PNhv'!X 7_dNHܷyz tÖ\J? t$:G-{tKV WtѦH̑,8gCkx_w;Ia#I=HEV R%i:n&{nW;O #' 5{!oȯȩE>* Eb85[Mռh|lw8Y%Ӱoz>YaҫUo׿2QL"94T$&eRlW'&oru&UMBVPs LYG˒܉A9+% +%ǮTwPw%{Q]EdYqsܪԭѵ*xǮSG:j  5HQj2x֢dʌ]Ѥ2bWz/ϗ@ܵH,1 dh^+ng^Dǎ"8vw$dG̒6sjE>U^T"T9$)I@$nNO䒙G%(rTtHP}O8L`mޤT>7j ،y9Kbcuu1MZ?|#N4TijHIdD;Q~Z YI3"}?7DHInt|ZIWF(]ϋ͵t Ν vb^Wj{Ks`2LDvp@ yĸA{:a#H[o[B e5mn;vƽcIW]J}K\#421|ƖHh ~J9EbVفh- /0HY3\-.N Xka$T(;G '0TW j6-6(tYS"F:Y4X$^6uPCmW'ɗ1P *A>\򻺮}'9|ȥ>ӂw^XCWzÿG{jxi~M'mk4H4l8~уC:7ehu.A|/b?w;p<Kt~ r_̂f\! VysUB~[Qv(yItݺd!v5 P+^߽fB:hvO 7K'?kĶKًSs2l2EGϖV%Ҳ<8(6XcRrn8tyoҤgC^8ӎ;: {sx[yq=b}l/jIE#ɨPkWlK"z3lO%plgVsbԢ[-xK[݊+9L00M!̹N'cN 7 di!!YB#{ CLZ@=,dRc>x ȆerS:mwuvA[`~Lwhc㘭y*FNg=|&,h~kMD>\x]đGz7W)??ǩ6[ fۘj4ﳥ KK8ݍm_Hl[4;͎Zgsg/t2Rkܞ$q(l&yݞ~ e *)wPų[gʛ wK&2$J}wKzg8u]W`-6->: d3vݝw79ykƓq&?–v)=ʓJY~VenʥAz;h<Ԗ )Y)mۘ0XTE0 h:{!f6t6KV}6Z-[\M(Dz˾gƅ=:§)-nd ŀѶ6u8,|Z@mWWy^6k)kyfbx#GMˎd̸+UX*u"QMDh`n"<%,ZI3GQbC-6_Euӑ{Ȱr!sBWUF$ȤL2ȊY\pq r*P&20ix:bKv@*K!: ne.R@'&+D!V.pqh!:h"}] F(imؖJֲQKriD](ޖpzOD&*^ CkJ:#+9Hia Z̋PVT oIȬ \8=#u,{*O 1W<g~V.ȱ}\/Ϟ$= *8AX jW@. I|F*G R}jrEd+HTqI\"x$'F9 lD޵4/M}{?OČB(UǼ?{~ evlPf:jЕKԥ~>S:in~1d)>:g"NICb*v=R)c !H_ทP@<,CsaTFԸ\rt@Z!JQD!!7@L'c|Q"#̓A8i=7@L !5@F8Nr.'wIJfl̶?$(kRij$Xq*=/MHOJH$~'q0*ٻr@CƤ9֮lw^8.*>H#Eݦz 4puio̾x BM{9*b#iq glj^Z^+R{ fp8hPtfTN9ZA1BN jC.FY <%RxO)N_'9Au%U7!ڞW S*^Le(`oyn:ka+633"%U>*tD^ V)G8lL/ DYhj  ŽiO,nOMvJcKr-5֠vUaA<$]P(r : -`_%:%&$K9Rb2 4?Nn2#P7ЩfҨW\LBlt%+vUz_E4y;c8Mi&JHZt -^= gⲑ )WALJu(iOQfQ柴:Tgڿh Z=d7RvɹϬ\xZ8+>ɎĖD{3\kZK]RZaqinIVvקTV?C3;JxSiSE4OYvR:w] ,#H3Lo)iv"G}1u:r.)!ᇙ4~P&d."_ 'NU*ht4 E:ɕ,"MRv z&c)ܜxsIFvu@QS-fPrH sEoN_9ԓQH`ԝ#LgHᶵBx]Hԧ-Sgj5Y\5oRT€TԳ 0*IݎU Ԍ7_dsk>{n <)yemgٹ%35^<.x> S[Axk'r쨏5OmoN]^ۮm'/9 >(Ov؍" #6xI{Kbw7^%rs74@K5t- h#yp?ʫ$IrX_I:@DljLcpT Zao?ȃvH7$2[vDjϺg䐎$L=f=CtAޱtn[B-LU_jL!f ~ blHUpQYHtX_!qn5dn6^ϙR_C W\iF*wrTBBug4;]rՙEΧJBT˜sg.{ΠPIa씿CP*"RWp^H.PS8OV3J PjLw]UQ|]&]-4Ƥ[ jc7<( #[CX%ԿS(ciYo7oږn>YeXy دq {]F 7Wz;]$0bAJ8Os>YG%zS\.qjb 2 alec;8mr&WNpvNSC56 3ѩ]MLsP\)2Bč@\Ʋ쯹Pp[y1F8B\-%D-HtNk0;E@6ɤKGVW,%V|M=yf;0 dC b92!R.RB eUDr7o\igyq ˙svgqqhQ]y:7aT*~ASL;88[>_ȳPV˞QoDjʯ٤:n݋~w"NWg"*>zryn0]_nktĒ$LgZ @Ew69_|xCw>Hь"ٓ^Dz-HTFX̶!F0`0ZΑfxJS|_Ck9sk l~g x.ۊC{qQT9hi!6([sng<&nZ/Q6RivIɝ]Ķev1"RAsq6Yvxc"fm/EiV!2Yk*2DܤOO0 oIx2 9cps8F5FM3'X2};X4CϤ}v--h@iG,DWPŽ7;UqpĈ옒QQ'0g "Q)g'zbVzIu;nOƂ&c+jڝ>mEdi>ݚS@qof7UdWAMnq oN7eF#Q'ŐpGăNl" 4Ktʤ_?pL[i&?$R^_߮$7 l =P6E#hy(JS ^DER rTql>nrTʹ%>qֻ|ovnN\uʝCނab\P~!oCd){O(FEš}y曍>ZoY/@ @<َڭjv{%$^ Gq@p,W̍UikAiH/ !بqB7YaıႼr/w L&55ԇrY̳AрxFH)z=O=\Nؗ0#ZLM'sE=|x}@$ 6P]e-Nx7,aPcgv8@ SR.P${(xuM qJWU${#\_l."Fr.ng\j7ʳ. V2E'a&s!?yOP",۴|R=l˭:`*SJPR$uqu-+; %g0RoDĠ0> XuЮQϻ[+{/Fu >Ezw (Yz<8sf|\=ྤYAv&*&3 Hק"N=.9~O^W:Π?"Y]r n @WC4Xp*љج0~IC誳HN-GK]civ'76M :b(F000EFyZ̟xUa*c{0YzΜEBSDQAM+ 7eG8F/a-ƐA[WRSs- fMPI{ ~sBbe5@}Nځ|zÏ긷+C}="7ůg;#ر%yd?Q5X~O)P\,O͆@WSC|޺"C^6< _a~//~N *V|I^!v4c20!4ǛR7Fg udv=Ek[hީY4mPw~_vPDڿ9#`b*'1v`BoQQ)/:%/n <ѝK,ZL9,s^FXrl أYѰjDxŹt=}' vJ:bG'Do`*DzRÜ%{$>> GZJ+R3Ѐ*[;9o߻+\9~=nI@rZ f(im9']a%?ͭ+q,s;`0iRvv7?e'&iYJ1)AV0ܯnKNzgg50w֝slmElcXAϴi/ q䧬@eHd(H@ JBLuTflX+WD@EʨTpGRDZS)ڼT=afeٵDj56EGcW~:”#9(K)+[-P+X|pEf!®unyF_Ի8w}1)zç?dмcQlnGqeջcL>q+- vH<"1in[ mr " ͻy?l$^,n-]X%ƇBZ>r  iT.!/XR.2д+PqBe+ZԺ1:šLFNo?Xk;*ڃ^g5kBݎ7{-;wv_l# ( ! E0p~M0_qEGv(XZ 2%/>Hk: yEu2QQhӸI;@GNs'I_6Qq[3FL 5e`x'0]U!u:)T́ہ2A 3}tvr;n1a22+*?,m9TuAN~pz֦ʅx!HH2ʽ_dQ-8O̧=loss=ջ aV`d+Ϭ6 Qs]:ZBZ>{{1PaGWl ۳t{S&/"N+BhAR= D>i;4[[ϹWpY ]u2js2e &GEPX|cl\)-"} €(meWT,2.5&~p kVXtل.y! ìS#!z#)CwP` mN'\kkFhtEk+@$ns|pA_^Au,v 99\j`7avi oWDwإ))AŝuFQCkFAVh'*>dNieV=CI\n;a xy;,=In˦b"9BL4.7Y/}KeCM_.iUK* '.9Xp;~huc;G~ϮE+c˅0}- < 괉OYS#wSZw^w,NZ]q&y>?뗼 s\`W\P{z"ʆ/0Q!I=Lܚ^$>|;0Dwd)1C E L¥`3L%]k`DA]T̏R8< M9Ӂ_\υ571X?G5x@OH>ESgK̳TrdX YX{>|YdwH&1;uPz?ì c JO?/_^^I/W&92uN.pf|"/BCxgÕ))*Es})$q$@ɹ=uuDNRJ&fHN_s,gX©/_bner7bV{(9*TuM{$'*wnc1a%$fRoLMה2:@9Ő2#!`j^Z{|yRk,] rBe-}0ZgK$/ǶJEocA$uSe=-@Ct)#髡84.jZi1Su^\pV(RtvRq855kЀpSAz/74nciR[)Y N?VK5@Ԧ﹩p'ԛ``RBJ]as͆kgm L]Yh3@ӮT(FvLȔpv{RdOݢ F{XYȭ+ W|HH [|-M ^V[CGȊެ=R"C(RoŰO-*|XQ2 '9(NL \Xib9; 5ݩ<]AtYarHӦF9$U7TsiZg7u8^eOsAazʇxd#ַ۾+SJ2q\GԈwÅPxIһ#M8K\Ѿvl%pAt.~ߖݳ M!i᳦0pnZg-kv}x1*=Rˋh ,f4e (Kb ${1g4\ >@(x_4=4R(L DY4 _ Ah4*_clz rit"#Ș$X"`X"L;a#6{!`76!W4E֓y1w)8E{<1d臔~ȗej\V+@|R* F2 IɋST }_yKn(Dރabwvcc #XF:30*)l1=4b-aQ틚 }NWC3k05oU<m" P65 P_^7ti/J g%~2K̒)."@!!RWe:J'wsf:BW/jZa"׏:3Dզ~Hm;:F3A=} Z\GkuAk%P1M;M'z&oH-,o]bm=lS,C,4rW;ZNal/cjPm5;l@;DZ&wttXI#mMCnR@ڎ Nd8N!5"/W}RbQ J;D~=}_.L)w}fy]1 '5q /sp?Ijzy"}HY/QZP7S N +j~B7$o9ވo"ײT^vaW^K\XoL>W))ZT\?e$Qpa6綍aC>Kx9HjE0VKypzzjU_]-1Jҍ'oFkQ{uX1lo6N,ޏ5"!1ا]xf)j_,1PތbNBb3M{/Rso|5[/v3Zgiz_(+ &Gz#8l\4܇m^ #t^ gKR;v1=!CD%Pge>(WJgۋ+Z;s p4inX@FYĻyV:/qWvn)$睞b*EuhyPЕݕm<4k=z>޶SebϽ7q]k l>=R^T52=.P=;j/tp7ÿ\f]-I:ReX}*8Nf t0J!E驮"'$. /üBl*tĩ* [gPضV9wz:%{qe YE@IyK'!Wٳ(:tpʢxW;cے 8%:s7Z=*4-iSAM9ujEH&v:|CP{L=e  ͼ)eic9 I#?b4tWyyc5ěkDi'Dhs]ϓ+uc ^q gD Eőrp$ ҟ!EfU ɝ+19l4*MJ !Dfy0.DO0ԬXo'ݓK3u Qv4od#cm?wWv6gbtSj.( X{\ҫU()PX]_ QM"ZJ]J"qMx;8@=ɻ'~i$cRқ'ӓs 9_=mfTMl8=m;Ft9?W?Xu OpI_5ƶ1.}}bȳpf]07m/ݮZL/斻QZY5I}N={}΍6K4[4#U.rD:r54׭8P \`I>EwEC ǼgOTo-3lL$xvW b%/d2a6xr劎&QMXXpnc !}][8^ +n =JQ 0BwG1~/{]d-XvZi4=8`d)vt%~c\ŧ]E)zGՆ{ķA)Q{>x]}R`qݭnd3mq)-s'h01Ą_,})K\FԳ7\%Ayi`F?.N?Z.𺹯 5ΜUͅ󟘃@(Ho=wJfG9A3;FP#Y6ݚ8paqeQaj&y duvD"5/R9L'=ګ^5AEU3q;H'IW}3~0II$05мMO ץ$`:`O)nzU049V~ @=~{5< ~G'Ӵ6:RH|pxj7?^r#я~,K:%՟Mk" 8ѱ+{lXഃ֭AtgǩC`!K =І^vug_Ss[kJb88k 䠃-'d6sԧ{rOT,inkrHҴ}Hd/鏺,擝zh6ЙS }ɮ7s͞ksDA˰ BFE/ U Pg~y!o]$)Hbdm0 _]1ʱcTɡQ^Hۏx.|u N]0)RUZ*Dࡕgc9tW4h2J5ڍG^9Gs8pnqn}ә'rnʝnv~ND:@k|7=ʖ&N? 1?Kzٹڬ!:^&ɸQl:~|9ѩʑ.A8mw)`8mxQ} PXg?b &y!3s'v9NQC f۩ZEVP@P8Z6g RRWN3WưcexPSϱhRSlݰ3vɆVuא{$ V ?\;G>qr)- s HPpvmՓWUS<ޞ᭎ 43>bb-c tΠcL)GсY9'/V< Z'F~7LRbӳd\w3BN>{k1t<5&FsbrҜme9uB4ȶ?He4-8,O& 4Rlx/vV T!} BlLOzWz@:}*A,-O:Yޏr9@ I6{rNȩkyEd&QcE&$;yv2^ 2㐳dR2<;J$Z%]67 N-y1aeD0?{+J-24< m~+ujKnwߵ ,BQK&5@x"{xĊǤlH؛Ƶb CzϦ++ +~VdPB#um.H>X~Y OTN]tqK.95w0B!QWñCƘOJ[IV>y.&l_}$ |:ӑ Nִm4N}4[x^A  WG_,#O4yTh׽Cg]*fƬ IL?ҫ%In}b&'tٳ/bJUb;b6ՔZĴab;(CQM (mK$<ؐ%89'2 ښ2 -zF=dq3if6'a[ZQMxkofzc)#;Y+I~s&kVpvV D 6|RNٴqbʫ2m'L49)1t@s-SLWIb1>(Rhu DL@i:cewȘϣo 7 !)qjб:klcgs@i^2 ُ&"~ yP8G bݼw2KzǰU $hKǝ̗2؎T6l5~kJFv0f Ԭ@h ^qD.fө'X45.LgFwMͷbIkװHӱLAUH~wBޅEb%[eZRs͌j@֖l,>dK9|5Z?˞5Zv W1MLˠ9Zà h}aYŁzDx0ۂ8 *Xo;BlBKOmZ=,z7w:' r`yu|9`{sHE?tHYqvq{6^$ []Mp4TડGDuerpq7Ҥ&Q'z4à_@i(ֲ=$⑈CG+*%PLVL.0a"$N,4AӨ,-D$P٤!׺7%NLĢ8e0sr[XF*6 B4.ua/_??Xc̱})[zdzzvk dp7$4,k gGu|o  9.2{5aN.pѰQ-ထ/u+N}{3}%1,3gʣ6o~䐖.(5Fm;x<.&,s[{DxG }':>Jcu"R搂+f3ynOj`31#a 1ZPƚ[TESh|*5 X[j\#X'i4Ϣf4m`"꾎T|=h4D`{¯n!IǯV4'w Tҳ9qz?b%߄2ۍz/Yg긬]#nx~q̈`yaohloCopxk ~ ުmPaGssC2+S~E6;4rđXOuQ|mpc`b/q(9;pX'v%y9: ӗ1P zcwàwk&&XFՈx#TosoC< Z);rũ~pwluVazKH](_\B aCXaPv*|h2g  YVU1N)[f<ȫ̯ZiN3 |_-C?$% &7R^6\񒪿b/(>o5=![0|D)1vi)yλ3.,)8 gc!9 87 `o/0-biTL@DipLr@sY%WŞJ!c XjGć)4J Yx }]QmM2pL})B n ) :'>+4-))Җ3 )GgKH⴩|"IH"Z6U$_bPyH!3(_8 5]i- J#:e0%U xZϼS( ˆDDj5/TeoUĘuSm--"5U너|֊ êoFQW x":>#t+*Ivcǁ{Bp6dm6f7l~Qt_T\8_et4xx;:݊_i%%AxNTe+ꗛ9gd=Aܛ*W|=fZjhD@0cD"LĚe6K^3[-k„5XCVhbJVR5U(nV,rPF6qjs[rw14JrT<ЪeDAs )/n`K+G & گ8ӆd@@ :B "j72YG-<%,g:f 15dMZYߣ @ܣHEs`o ߏ (CƀqRU\YGp0@  0t*v}WcʪS)[0IUiFk09eJ虪0b} NV˂oF a J3؜u'B(-ԝ 9)~jQ{cgc^8& MۜqDK`#n0 Fz%r?'[i+8MJqջm:I8 E` '7kdo 0>D:S(7eB@$,vf9aDwV,A'@@?G;ъN"Ws1e/Lm[X$%!"5Ibܤ svmjMNg7\ռ#FnTUaכ&QhtBʌ/ѡ^G$%g!phF+&'"` (3 (էN4|rA+Q#ׯ(Ǒly!â1 33U'%1t XU_%,yìPmk0L:zW /& ͮx{F>R_7ۑ~-2zZ!7I_&;'ĝ=a5d06sȭa8wVX]n|3afP EJDUky3Jk$$HD>ki3JrP9IRE۹۹hP(M8]١Y*Aac͍E?s.l o|;H2zK%RRodo2zL d#1{VgNCvt;47>!ᨒH{'yTo!^@blfdJD^CoTaGWq59, d˗kfz/ VNP+o 1퀠FZkyL6V6yb&gW+ aޣz)R1d53u>sT4#ބIaB4{wbWKu[_-_B<*}urOdyZ)jˍ䆁>\(y |Xq-ժbQ.'D't2^"BǒtȺ}o*xeXH8"I,Bܰ( Y%)q[?*-%Ic ڃ } R2 Vbo$&E~₲w)NW8{S <(vmgs]<\PJIqYڹ JPHe Qel;[A!:>uA҆=H( $iǼS5kìDΫ~MxzȺϝD sJ_nP-9ZZ0fWEtd 9^:e7:%laWwtZwůFi ^ofv:!ԆFX]q$ wkH?ќv9EEsQ5xd:VwL:=w1Ӣ`3E&:RQ9{g-*PL|X#kVx$4H**{b6xŻbj,0I+ba]h+9E1COɋ&qMAf uCMn2kڤQet[DŽ%̱EG_*s#}țEop$ҮV,IAl dߛMIVƲoAUu1qG|HRH:jѰ(6]3I| Dl~IE8%b(U˕гW@%bL% RgN磎]n܈,},oEi0Ig*5w%lp\n|.f/*vw_ϛZMT]9f.nPi_ϳL9w03 >88v΃̜7Q]nz5j}6MHY F%0h` 4Om]5ތZ:SǤ4Q"'kQvxMG$jxfY{vi˨%8?>5[ U|FЫJ[ tװNd"~=p <:s+MⳞm&KvE[~}A‘NTmq .}(C;PJ/@_df[~Ԡμ&NGF,2ձX_nԒŔovdw-Qz-JexoyL@9y E<dy޻*=OOn$p8+}\Lz*R-pw{X"_̛uàr@6 USC1A)Q7t|ՙY!Jo>/6!RUL; F\nVtZ=~,.o=HP>kwRn,'=Ĵz)*k\7Zt:8l֨ykԶЖ1LwC[n}CTXdrY 4D6TO,#oYM3KDhW %Te8nX[WvlqAJvug3A=:򽺛؍l@iAj#MXp Ky;{/8qs_ٳg'7)ԓ[lˮwRImK݂;djs2+) v+"X/[~*@+Ua7Hb,?Qgϖmk!p[覦?wݞP|KVaxFkUs2 |wospkv}*WUɬ.8\)ٜyg GVN)].XζP.s Sͣ]XRߍ!_ߝ~Oۉ$91쪿waE&+q%tVOswإdgЋncSx;s7XZ`>aK]cZzunB!XjI\ǁw;ǛoGD"hpv%:xԽ^kavҢ] !oq*8nVHy$%"Q(Ql*>"Ixs[!IHJX^on%J,pҲQg$:nZ%l}6Z@M٘[&JP,)P'6 qǚKM'ka`RZP6`U`ocԜ6D(5@9yGj"fNLZr6a=[L1NH.ni2`;2 -n8Ogԉe*n*֮phEzRQ2rHSƏŮ)n?޾848EIq̍XϞ9>n%%n! yh $@ sHk܎;[?=IÈ]wZr:ߧiv>2LA7R)o$m6hs~jN٣@V|w ` FzG'laC(?c\Qb<#zzebd'؄JGs>y&{ovvfzDa_xnk3aw |T(ɒ7.L:RPdE5DRmԶ Z#wvαΓzܭ]R#^pSʐ_#Qs3/&٤;QLܚ{QVKWRLDd[ ;kh,3ZCz8EN6Q-Д E| E'}E|+ {|ά+1r]|) a?)ĝuBHWխRcXV4mϥs3 Q~miZ|rFۃm?8&_ޢƑJNN5n߭޽%0|ɚ?C #Y{%kkB1|<<fxxD"Ǝh!^WxWZ+xHMMy˶SΈW.ɚ+Z C+pql) vn7 ݷc<|qyppV끅|9fUxRW9(klO8r v۲ު{y 65kOqtg@=?(]'Eq NumlkmGo}x 8gSGq:gM} حޞ Nd^kjsSu MX$*Ud5vsX۟/ 6ȺM|Z :Omʢ˦G%tOFZk+VԘnpfJ^V0FV0E?ѵ;W9bW v$Ioep}S5xlW/NpjsyQ2(~6*FENi&-'RWaG$)"1'm:Y^GsexbRHy˷@R퓭aQSΐT[W\[b<K\.&1.@ӻ%0O٪;e/gY<7G|[y&dkY-9(@. %`ܕԟcgީ/c0qL&HoKfJiCժQ ڜ_[i}XmK>jKz p)tj#+TK%K2CdsOԇ@L}j˜@+R)#DwCzlGR}Hj< سPl]IbruOf3i" QrY!>8;$^@d;@RkD_1՟3WX۴vYf.?g.E i (uG_7 7K([Z@يrV\(%ZLdD٣XmKӇ>@Zk|niH9HD9q&]+-Q*WqU?ȓnn<. Z]L),?襹FZ|2|_wKN`g jK7B #A(iɒF3#6lK$@d,Ywl ]d iaħqib vAvԌ xNف_VJmk:4E-ꚸP/E:|Pi6Ɍ=ZeܬG2e~ FЌNErCjW9HQ!I:/Haj&)vV׋ITh_kغڨY*hk=?*tiu]u_cـ~7OgMgu g%ԏ~vQCE' QhYZdq~NQh?ӛoGD&HPRh$H'd'2Pui'zcÜsN~$+s񳅽gڠf7m~ϊU/(O0}0qs VD+Zn8EX.\CF!ZzɱgB ٓ9'H$ Fv[+eM_ߺ3j{bVY ޹OrG) !"oytĐ/G*pC5]Oj k@rE4)qx;q}-qAg%يoק֍uFDIO#׌**d6iQƗ#J\rvH]]kaIMa[ @GrɲƓg5k@Zj5yUP[|gsÍݺWs}eă!q%z ĜX:}nV7&4mC>4Ve1)ի.̞| Ut(O~zBI N@}dI%Q$SS?k mU Q>a{, 6dvG7u5"%g$* 5ܚX\y=D s~(0ѯb3ա9pV[.Gaoi9o1}6ڐ/'MeҷSn.{ p&%4ÏZY<|ŝ^/s3Uqf˥>%ErϮADW9Ϟ0fWf%ߑv- ul8.BUJȢB$*Uw׮< fMVD:njs QU哰7`U_K‹Cϼ/"t[AG2HU \yVf)c]'[+:{N !\p8TCp [Pm LVʈvdMٱ.Pg^e]~'C_ZZ6g(prL5)%`U(n@&)IaTp.r\*Rf#޾p V:^I7blXgUXفoBhU4JZ^&QRxM@#L/CǠ0ڐ|[n<io0: Ψ[ڡ(1>.˳7\A] nh.]G)@ǀU|w.Js>} QD!v#HwBUQt9]A#}B! AVvuw̑)Y=^hU#xD'3SOdZg2q\|aOs!1-!0Ev6QM& % 211ݰSFH@_Y~'s` *bGDā`)LDܶ& =5qJ1=QܐKfCcjܺ .k9*>U^yh3lT~BXqёS? s :Rlԣ|2# wHIv'(`nz*N,:diЃ>R=//,%T;CxTr%Ī_8;-%Z Pj4嵞wtYaqVv\PsDt\jG@os FMOdVnVC#bgANɣWgkJ]uSde-ȡ8{n]$Ɯnƿ;܄M66!+]%rP4@ zɈHt4F(b)P6/zAh PO#!$Ybq X$b&(rĥ.6lD{D_G<(ɹφ^D~B~v9DiV[#3Ϭe0(pcqIUV*+ej0kDߺhc,E}M>">ZvPN!~#/8S܎Hk)a0?G&c1(R~D!^ hB =FCbFOő( 뺔y)kݛ ;㫑5Pi5^٢g.g_qo c'svN`</57B%uۄ6k/0 r܄?]T7S΋tr $~/]FCY5E.L&q^cW4?/40JZޫU hxy{LwPi^d h{qr)WuCfP1kè:Q _Ko(5x)mq[1W JZz ˄WWl& ߛn&gV9A"#j\͇ B*FMaӂPVסJ0&P1|%,")IGw]?90 P͸KHCӝL8d|{3QyNFFC3 &JAطPlq[#Z5rS]cx‹ {v |`sj'#\0-z2flsMp+Ɛ,+n46LKEl7\2O: .h'ۤ"-}A*e=!ɰ6zDֶ_|a~Pth-Zy2ofy Oi+d8Ց.*72"jIrׁw _#w ?$om:6?j2%k#<ΔNDW AgnK=ԳeQ[.p'ב)FlMp2*r'3!yu} R5/VזJQv gg=uд ,&}VIZbsbWpIy/x|!3E[Ul.cоI1<+9 t3U&^ sS<*<|U)6kZz]/z Wջ%sζd:cO$]iR[-4vJ鏳9|Iɚ3nϼ?k Z_;:?j*va < ԉܰ;Hm1FhcU]:l5FW*Pm'j| Ib jnNyAڜҰeEG.9ZW6' 8ޒ|S.wtUhɷs r`r1gZ}b~37 vXeyvGA@1ңӠfYN"笕\9F ?L(xB1,7 *sX-Hj [AQ\Т lPj{C J|e{|$.ī5r̅)k4܏l1 #\Nr8X\! TK+_bK|r$*]P*00u||@ߢ8j,#~ #I`pw50_€3?WF|(as>ao>P>(TTp#ʝ; j.ReBhQ`gJ=(NALG'aHs=a#LD&=*?ظ 9A<\G3F;3Y.SpS%m0rJ|n+5 Ʀyp|lђF ?5j;K멾Ϻa3KgV!Xn ʇt> Bgm֧M$1S. /E(tUF8%n:UDpf'M:QB$-Jw !\5#qQ: Y/8l`C:oT靋`h}ƟH(ʓ]{Ǝzn?Nĵ~P T HĐ!S~*ܺQl* &qM+{"UYbZ|GX{Q1:&,=Yƽ׹Y_P[^ӞW[3?aF6 <݁Q OiꖝtY]&LPՒ8 xB͋oLJRgSCfȜ^ ː=7!X6Avq/ yLd"w-rڊV|\b 8o(=Lq+w!Nɋ!"B >{7:!E\`.,.F%G$F_0pz>$"Z&CRl!]zk.%"SUuk:jY/!(38qu?t\ΥSr2aάڛBrArnO=}{$tSdql'ov.a@)擂SV0;~(+?ne[]bĬ7Y5+"آt~V ]MuI 6PZi8#2]W*麴[9:֩H =aor6~?ƣ(HȘm|4r'U{vKn67 TTͳZ: 5|s=N-coɖ8W=<* 1s\̈́Aon0u)I(c; g.I7be!Hd!gmb;"YhvM-ʎM ZWW.uHlcӰ16ۤ[({3(1bJIV1"Oٵ P0e }CU˲bNbTD>QV6M^%+>{AUEm٨ @uNXH/O0CHN# 8(t&YaMgD'$s|$̉u%l{~4ڠDTK=毚ElEt&//~i)ţӚon&Eh낀=( h8 M:LdX^ƹYy@媇e0K\+r'Iy2l/E\7z %aun;ؗl53KSM!P# :!E1FR/Q B;+8ޔ>bL?,^UFGt88[U۔i0G #t.')C`; *gՃHX'k F0(9* p#-jJHrgr1uPŅ6ɎlKzX?ާJ jeo OgN4pYQ JlH\=3Xp?k+z[7 f~1T !?q\f;hJ`?Zex*$ Ah%F%vf#VPucF@aM̩J2\ߢ"l0jdJYpP߃q];>LS?DQƳRp|_*cGФTT4tlHg(BE]]cI}jAq֣z!ƥĨyq?4z*D?mIvKQ.-$CLhv!Xߏþ2|e@=tWGLMpM:eV*ώGeeJ@j3b)úB?P Giic2G= t0oW)v̶hȕ$MJGuEQ}}T7(f]8E4Gm{IrKA䦅dlz0 r-22Ē%Y6$R'/)i֫,ۑnVGԽ$@RW ۻj_QXB/&cQ_"-+m?CT( ;aޟ Rb=7H/ɔ..ʫt*S^N-kN҂X^kyfxӐ=K8 w\G孾}oTeLW|"G"זnDixY}<&cy^gn3hP@'W{!ԤJ6Bcn#"npD((3OBzor)C_|1 ȳ 4)hPSͻU۠CC$f;,(!,pTR 9!)Rd"s)DbNRJҥK*]( @ 曨a%7ռwm!$ùg65Wm0?Puһk'TD5X߂T7f.^S Sj?V(Lmߴ_'Td?i7DI<~c1D} |#`G#!.[!?h4RN WP!.)E_kyΔGUc2OZ9Yq<iͣlW3UՌݼ"N$uC=7-ؙ\N\k:ʏš>AE5&"1^3ŤUhFSAL7\=G6 jl[ kq0ǮˠhUwWa jՐTw]%D%GaM6\gכtT(YfT"G$URصd֍֣2Ǩd/a1;Pm.˅h'yZ_fj5,z:`M?N'jn@7Wƒڝy,cǑR=^h~hVĵ$V\Y%~(8ylawe,͍zL e\>J\`,ɶ]Zqn]\,տ$Y˰n$@2$2揫/r%ptGM5mfI Ew}$X0cse]dkӱh oOGk`bΒvK<΋)ϱaYP{ Ufx0Fbx?M'v@(5Cj0k|SIiv*,iم(8pၓlfM Ϛ8nC1ʧ񧮊Y9)jRV % f ?,38xU})Zb)dģM|/ע&OS~WO딎wAX&&>UѿW)ljd?gG<7F2W)wADwnCXTr 5N滲XՄjC2iCXnQN5T?ՊmbnI6񗓺ŇYOC[bGG }uh=אޕWYgyQx\Q-/>6pC /{7ƑfX( -Ŭ0Q'-7j2y&@ ]㕏1wcbLOi(=TDӌi(*[J C1Fƴ> b:"LuJOǶֳ9$̻IbuQ^ 5J|U[`ͱR!'n]WI3kFxftN5~c\AĤ{ J1Nw9YNnP?EȨޠTjl8AZA.Ɗ [hR)sv5DY"c-U(0EmOɘa0O QV(ItFqkQr5&A xPա%YPzj_?M1E %Q5u8]Ӱ/"Dp%}d?ad.%Gc{7!ԉ&oR ;@e|Go5, wkZq(*b LY'\ӥXmGq X:W/Hs \pݠd=Iw\O6joO-|P'QI(TV~];]Wi_!'Z5*\&Ss=$G4Zcð>5#uuV?ZUWvXGuv󁙿z~z% *a`}ܻoZ<5h5CUbb,JYQŌPwn}MP(W7J}4e$ʕy/P7JMJ=EZ'\Iz2*r%څ[(7#2V/n@ce# HUQX-YQX-WQ aCEF6º%Z\6 (~MWIKuCS'jmz_ZlXg50^SuM@Cz _@?:~#F 2Ok{W 4Քqy=MV% 롵 KgZHqV I`%թ(/Ķ_}BeqͅseٗlY4ľ3fY@SB6S#`iV:r}Tه\|ÌŽ'T "@[?#XŸUߴfmfۭ{-)evqX|x6{UQ_Nƾ[>Y6Q0V}0c1r(_NVZʒ H-⧖>_L۝k?~#[$G}*g fy)UTv!K%Fs]AoǁGq"GQc" R! q2|xʄU8ĕϹ w@ɥ0JJ3ڙhs;Wt\{^>2oO]3`7o5 - QƩ> l35br=έʘ-|ԂdZ 6 n6+%= :X (/Gu?7d[7UG=DI,eb..c+qw{ ݋N-hקdP=!;}{ ۾*T1Q| c")?[h'cq$c,o+<:vIf4%ŶknPƽ4 q!Vd4YubypZj(tK& Xnc"F_uȷ)f_BzŒ%UG2%0 -1*~>drb"'y7ŲSi&#;/[2&,-49/5&Ӻ,r7&:N0C{K+1׌9Y$>Kv=7 3ͯ'ՂI:Zg|Q&*TUAcHx5g} ^buwT[''ź;D=nZ:3#DPI.0͵CM)*[\2PY{UG5F ZF r_TN@3\AD5=)8*]=] kXˈ\V a}g>`617Ru5me-A~6 [}u;uІ&݌c6|yTq`Uz\/F|G}q,j+6Py&!"&DH9c̶Qϟ^e)D,Nu*T/J-m%EeMiP}H:OޭPӪh<5H;ѹJުPME-`u?ԬSGRf~Nߣ<}R=I1~OH=)LRJĹҚO4pQ/t8PR}i@_D FvuDr U*k |RRuBє/P_ʖgANQ":E^/~)~3Y,h ,}aO|JxXd_4ԯ@;n4lpɊ5 lgG~Pd5يߓSk>oGdx; u_$:.B^*jO1L( hD$CGY9;qn"][L^x!ӒM ϞJ!zZpgh+B!'t;vj߱,/HսUdz0omQi ^5 Z7j^[{9[խ4YP8#99x Y4œe/N 23ey .uo῜d2Ld&'{SNgRSY"Yj[9K$ˋ z &f՝e$I-ɭo]" 9CNYȩ:G  N2{ѽ;g񢢮Ry3)XѼ(!(cHdmiCxC7SLr6K^I S_1{T ҞNzg҄'W0}(mRڷ/'Ɏ)k)~'-ypCOrI,(ȮvYLM@cTaGqm+'=T~TfxooSsZ/ =6/ B_SCӓwtZ҄a'zz-70۩aB&bz O,vжKOxdaf.grXֽAe՗ݽdбMY'4t3ul͔L<3mpnd&`ySC))&3dmgSgSM S;EOì^%i8pߧ/އ$qh;=dzSUQiBYP^fZ&:T3KAM HPu([Gv%vL/hPqQG=5m/G5f1X8Y(Fѭ;YzF "q=(ӦEb7w8]h <؇?:}Gt:g:é- 5i=y:H rmADYV*06Ig̼M+BlA[S@;uko%F9_}?k4JZXe'RȤ#wK4% >j";1?n:/3 /b[eo@Dؘ,E>˽WaoŒ{RXX<z=Q!U#=# ]"Of>ж 粂Qٌ]yޖ|f gVK)EǏ_dJ}mF&‡k5=RRH/ E][Mg:wgK.x1f( '*Mdyi_j>fz<ާLt Aʋ4iS& qK$X?;hҪjKf"j0C{My,VFK/JX&ff& |0%$[4#uEڲ`Gj :E5ϲ$+[~\љqseI 0`L Y׌PQqV59NI۴jR:"2KE ό;OHfҘx~_9PR)j/e[{Nĥ\i_]f?{!_dBٞVYdWKCe۶c,A~IGM]= <@Y5 9sρw<#귾nBٜJY^g}<E}_#T;j2pu;;BPC"KB!P_Ր#Av[u[ֹ QhAVAPϺdҏݮ&~K%G=k(Ѷ@3.Y3ߡf?dpY.Y+qexWLpuD")*EL\Դf!P􇢞:{xӖ}|xȻ nYn"?-4Nke\KTdu}kT[X.-qjN Jчbk[[h7GYix?OD 보asiʮjV9'n]1 c}0S'F`ka|)F$r.9m9̠9i<12"R9kLۄ|-LFZcRБ9R,;kv?>p$mv|$_b%z19Y'dJN?U{'/s'uvO_J*-0O|z(||LSD蛝OՔ^xxOEkRO]ߟPW #ҫ>ڄڵW JAWKFs^z!Iշ'_h{[ &Pʫ3]C4,Q|ҟs墤41/{ɔ^=\䞗pGJrzLHK4K|O/%+mϲ<7|'/WQ<,!9^tyFwҴSxM69\9{ -0W;D@x4́I[yQ|ݽˬh|yHGNAE(ZFԑT-EY DY\ iom)+4W.lF6)A@Ʌ #PD pk$Il/9,91UBcI;7 d[s7~Sd L@n2q[T.B-dHM !k 'ʛA,ǖ~Y,4i'[m EE)gE5vJ=hH5JFNVkQ j碜j/Qd[0)KGs'KѣE(#R7h$r"sXjZQ3-D\ۗmXVT\ŨJb[ӟltFi↪ Uz4ZI9F,j3.$[dDRD{&F%5T9"{%7B d|?Bt:䱎%{T"%_ Ew@+'JSg4?W#.iivX WMٿCS֝GT*=rqs;0\9GVH ˑȊ#:6z44XܩS'[8*13D.gnW:AhCF骾!+s#;"sgA;bJ5`Cݪ*[!)/W=+iI~ꗫhQTgOH(ba<^amHh[xՀd߈FSz^*cqtdV)(`Ga8hfXhh$|X0QöCZ825. i2[,T,yP7Abʈg!|LC c;d:z ?nQLnm*KGp-_v8YgV\C:57S]פPPygR׈^/C>ų5vy[C\V} qy!UWB ݒGH42Z&|_Ѫk&+[/H CFC QWJJIcNlrDv(q"q7(q:'UrJO( 1[fI|=*K'~#8cz`rb=,/<Ȋ%#SPړ#O4빡ଔJNR\Hlx5$ίlRZLqO=2E$sCZ . Y2G0#.Y[hNH9NYh֔?Wm@2Hb" I6$$Ij =);Dv-r %G5uID׻Ǽ=-e8J.=֗ez k|TH⹷8CzHU> ()08%C(i%\q_$yI )/պ %%W +'ϠƞϏ}O$3U ݑ+$ (ʁ&d K&C9.'o] m0*6UT$TuzDtڈ+x !(y EZr$KN|Bì /F ]Fq?ψEcޗǗY-7e?q =Uwg8?72.O`Dl:lvFQۋʩZNOy~5joOG򜉪˓I)vxHrx_ ^ćRefUٽ,K `0RG&ki!g#- k*K5vJ\բ# -/b&(/I-QrqW4GiA+_HnR?HDR*xHDE>tڧ^|4o~ HC/KV XRi{E閇W'u\oCenDKP9Ul|VH{>^`.8$.6l#:tf,!]r H9'9Ƚio"}Ǭ&slJs8ߥAKEvVTzGX% t%j'?b`iMy_ 73@*ISwJDXAJChV$4<k/)!.x$=9ֻԩњꑀKI^jcH;)14)SC2@2BORM(R\^*O 5m8IktnG`:<V K9 Z33$3J1C2rPw׹ ʪA~@G15Khp_Xi(4um63b:YADPF&:$j)vB@|eʨ629ar Q1= iΔ#ra,'_nKC7X4seM Æ .'/MH> O1 %t)/ԑ -b;.:UN-=Swu} ug. [i&f1ruɃv O% u-?;lLm)B" Te#_=ILMJM O-Gtc#K[% !'+G,Ȉ*qn"1k0a;SӢBe˲Y;O_!oԩh #aQd>psDC1.iehq׎0auWU3;| o_[ϔ;>lEmvQJlHCˊ -%m1ڦ:;Ld4yCm(C# ӿUa32IbKz/.oxҐ6#& W:K?5Lxe4I~xt{F. R敿v?8BQ,qLA46Եu 7H{ LFɤc~vuXt@- nSFXj Bl';FB;xl6sy/P5zQx6ހjo "EZGt]@ ğ?2y.[%`C $vj<R>)r(̓&W -ęOѸN9كP2歪xFA4Ҟp^`Zב`K֮'f>Jk"FB h/)_\!ҐlFmWss&n*)6Bx$ZrU6iG-õ:UG<.Q\*ݬ߁e',9:3$tմ3be-oeȴ]|º_A^m/S>hioV+FDf,]mыT«xI<_<5[NA=0<Cu7C#ոS͢x1Wd֤[YtSY#ƼP"66IؘC&r,/S Q /"nb1-*%ik|5'<:W@ior-p(w]R:) t0 Ά˕ؐ!.8%.j*3VO EE mŶՋ;s|'lY-8,(AKOU٥ao4@{r)^EڹxD)0AdvfP6$i6®/lkcdYG;:BD+JioLsH23UbԭӖ/'F0ْ̞u(ھ.ٷ߷*K@i| FIS "UtnHmL?%X2UZW#lWnyI[6iFMuFO[BsZ`n [13h@lm6$,@h;`aRm`ވa_k%Zwzrk@gMueTt4cy,{A&A–E{ؕE zC}gF97fî?Sn P\*v-H,忇48xt ƚf.i ~RWė(ߜƏTⷂSC#kc#]AiLꅜA M4;L,}UΏ fGd dHW6 DBM@~GKʫWg ,_8~ZEyH>d>{K6;!RN穟%jzώ(ʗ7Qd,%T%c<E:.%7Emu&:UZ3`թ0=:x4+[BHOToYh?MN emmWF (b̄1/qL]]$T% ^ ;P l58ɞa o :béO 7aD[-\eˉ=!nn[gO3淶xusѨV~fJR6,O;+Qa )\@v,?A$\v0>ݔ(>j" 'ODF.Gn].a2CvKA6V‡ =6i]ff;gZ_OGCb6' g|/%(̸O>N1gɯd4VRR4oJ ,_A(1M&O6oT؄}gYU>O/3Vi[.^?чŢpI$Z 6Jn.F+43Ѝ#-hQ'I>d,>w E4 iA -4F̎ŗqxc8z_.ZF@aՃ8i1Z [EU3UOj\ atDz m?{]ܔ>16:Z6WD-6ͨ[ W[ ʙ@4ku%@ȉӡlf^ȰYgꗩ€eu{2[g$QZςYשd^M0Q㕉V 0<Ό&:Yuh>8XV,;ggL5sZ2e=W؈ڌ1MSgUnF4Yrmlo8DSDTeϐTXF'Hwg}'AR'Y\g%D1L$3$%u,YѢKSkLɿ9m/f9fmdZ&%ePК=b*LhB2_̧*&Ȥ^A}t$r*i]C&B f;{S4T\<=qImTTÛKR?fDT6 ]e) =Em/Sߦ2NTb_(\d4mXrX?I5ZwBUDoZIJ`Y2Odaߡe kE49gvLXffNΆ>idxIllIA}8(6kXQ8@ f-ԖFEM'$G&EkqX\ƭugm#BF5öZ řUl+۰3σT韝ULTG:-?#3@ڸeZ]ɧ L42].A{'ImBŢa' va4"ʐvUR]B"-dZ lp=1$=z&y<~{\% fђVg'k7D4^# jn=M{~)k=OUJ9*JnChQ%hP+QL4*M4QPRsqٵ'}#V,}? fak/ްWyC9Q&k.>8O\Iv5sMȗ5C҃O! GSQr#c էqy󈖪F Eڿr!z籶យu|/KX6{9`9sܖK|Q ȶyA >޵zyzwپYh27{b6kK*`{Ҟv^VIw] {oIi35XRARdh -?J0n5W*A+JQKWQ4(qJM$]yZuZ( Us5tjvPf22 (s{l{zJ+v.Do<6Q7 ܚ}& ܷrԖh_U8ockz$psy IpW sdʊv|QGbֳEGb{x <՟5(ܔBX j 3Kл taS \uwǝN!RZ q=>3Ň>ښ`@^i<$tQFJvr"v:wla$% ιұYj^іN`(Iwrm$,%K|mXq܉o#wu1[;(vS> =>6 N M+:{јA/qPHLʙCf9& ;<IKr&a/K]2T˫ظP+[iij`iM4NuĖ#MtXxss r't>"Rs5)iv# 95"\ݢëS&U^xS{4ۯ:ĚTֵy/Z9ϡ\T X)elGe(Ecoڷp.Z_EOp2HuzC/TntxL$di uqb :}igve:7^sQ` ZI"47ğGq$Q?֮~W~Z]z|z4?֏ xO#|xVG*hui0C4}w tMwjl,o;q&@X>+<JL/gsv8v`/A;Hv@᧎Т#_EWZ~[?/rNc9`o\:;"18f$^'r;N9f76P߰ȕG WS OFl$f=ÐV8,~],r6A|%ڈa:#8L= nn^J3Hk@b+?=? <١_iPƚtG9pɇWqB(naeR9%}Col)S)Y[6]G>.f]3vl]iouaqMv}矡U^ _y8>K@LHŁa6F2^:7|hn^K1&?%q\^En;x?mH~:*"ʴC|..S0JxLx)HHfK da et,C)7g/G%S s˕rwá;}*i\㰁`IHg}\%\E1`A.OS. qzs삱faѥ#uM]5\{# HH=1qcr! ?& Q) (wH)THQ,bd'NӤ X{~Xܝt $"p+ |$H!&񉷤g i :؁< ď;Ҕl@M u5Wr dm3GAB!`f(΢d:;[,.60Js0( Y, 2\jL+I^fӉӲgty<73b{_]j~j i\x9ыE(zu#O**6d>S5ܬGF jt'4)E")'Ђ%|^hUwPdi4;am 7ø._7yo^.WEPӴLnp7?ǽ.G+gtBF¿Uy~#;'I=t{U.%D3xaEs2kǜVs# `#oj^սoiYK . k]6=eVZ$yĚycƅdƌGkTo9/ ̶Ȧb``x LݓO~  l.bOfrʸԳl/X>ؐe; V>v ߇ul)>cMOX!1, ?=,1Bm$Ctz>)[׈Oqd1@z<*ꯙ@{+ZzMaREIIMJCnXt83  ^:IH<.M_odJ]Ϋ ;Ȗ.Ncmx9(8ǡpXhˉ9&՝Wwze8;1Ƶ 7&Q.(}k%c݆ASb -d16pZkՁ'1'5b֭ڼ |jY~U%# F}^;  P罀@AL)_vGɛf*_sѸ|SQ,퍧:>V%;d׬û[P{9.ȣ1Ӿj"{:^Ui^rI %14Uק,]d*=/qL&\pu(1!M 4?U@tݵiq&-G2֣q ?=Elk`8Moihʮ79;dΊKFQb3KJ~5ܞ_jQV4`>[:&QF@ԁXzΑpy4S0ge%v`:\*xX(![<Ζ0o}X _My/j.xŜD7vd[yqS!yruEɦdɖ: }瀄0辰nӀN vYgI㰘*PD2%cQƾG0NM~k !;)hEU9rW&Z{ {a`'v=bn[֥;@d!n8/a>x)̡ikI+L6]_m"ȏtiQt5ULY#s-eBw˿d7 r o7a# TdP"W|G RZG)laEa65Ye., B-JC \fZq*S֗Sd/ö7؈_VYxBaYM ѳk5əY +@LXse}i\n4P6GiLF3T=Yɨz1ڴA`)Y gzXH)#WBewL9q>WKվ2 jt? ]צO)h ӺlioedQI ̻ۛRD}+i0mak.E T` nPp!~ב멇rvp3.5US[$\u?>JEmֵkTf wVk ʢ.ͥ}HמiQ]Dt.E$ .-.]<ǐ黐ejy4 يRh!CF[?ǏO%Ium;!-6ȕ5X%+|],&,{^ d Ndc-Qb:֒3BNAMK(=vQdd6=n+xW(UgCD+᰽C9cpjЏ!pAa󹑜hWij~jdGM8%bOHd>u#h7=dOe$ZW=966Gpǧl43w.DS){<ไoZ^M ъ9a37V cslzPD =$w6[qlU'qLg(؁4*%OCdeE9Sm*o<Ĉ/X x!jFhsFW\M=z(6"\?*u&9 >A}SL뉁9w t :#v~!0]d$;OA/jFԩ6|¡,:O<Ǐe1|1)OqAvbR`GᏢ53̙wwjAXx? &Af]gC+.kg_SnÙC=||zg CR|aъ{jQ$C߽h&7(k\DM؛|߄9On}ᢒT{cdt NYWEJ"͓^t\UAnBXˉ'BMhj"-c3s,hydMcCT@zzY/" 36OˇlK6]%Fm_ ,)y.&4,ۘM9w!?q6ɁVLL~VUdU辰dTokK9_jA%ob~t-gY|J$[464ve}SFYa qzn0RYADf˷RҝKsGWuq g0d0iKNY[m?0q/DR \ƬVq (4nrƁ?Tj_fa՚_B|YD$s)Rv2ÚDGju *QB*P U ,"inY+aւRZJo ZTΰD6QuƦ$RJIWN&sNvD3Lてdžbʋm$~9-vbL.vyg^jqA'+1}UFsa9C7=%FY?/48¨6cB&PI 9xb p;KR&"߀P |&EZ.IBFv~a [PT\Tnķ>/2Q .?dg"nJ.d~\~'B6(_؀wlpdYN8VNM!q2e{O40.!O q+ ?1#|aP0⊋9 dbQM԰>a+yL:`{<9)<6*aY1qC8/۶eA/,+Q7x1H|S=#tͼq " rR_P?`1)DjxGRPN'g{()$1DZ&z/ .YN--m I)2*C˿=DE,F"#(Hy)/%I87H?%Fd뚅Jv}.ƕ[?ĴPʵ CGԇF8K"n,hE/*f_eq[,bsP5qXE&bF3PVPXB Xm`c*Bk%+waD{F.vl{3/|W#Ǿ{4L!%T~a*\g۬WK:ܿSa>,)Yr͠F IBd05iRU^Ê:_'!_ykNt'Jm|@mY*69\Iʼn 𿅚&`\6ڻ)ny.ȯ[-7:=\ocXM|~@7f~/V'4agȷpjEN*T;<fY3n7(P*pN ja* ,y4zi,)%Nh/^^h6[X_լy$CTI|>X/Dk_S24̨M3jRG͵s 4+χP3>Y,y(<ܥ|P Ose u{Y;V{*S.[LˏfTͤ tEQ::.9ޓW NOE=Q ['(}ן_-"\iiSkI厵{Hs YJ |x͠kr~M=^ut;Nޞ6yCP()} 71 ]n. )>0vXإ8/:,tps:r^6 䄕OXWg>YOIM <(pxw]Fp˘I;F8~<uŐ2L$gCGp5"q͍3b%CάIַK;[=nNJNDԓ˞/Ml$߰k`=`f%qEd=5v(*$qgK10x|9sHz74ZĀf9anj66 ~ySO=K|,*!c1c"4bܠY{4"O,*W5df ! F Y2j*A$T Š'%f (1Y+(&=0(!2fC&9b,D2 /c$X8F҈c$Xq$ ^` Ā20IDCJIV@OBFIV 9X .d\\O[IN%JrK¥::SHA]f t12kMdKSrsiw5OpKݩS?NO\6spq %}j7cãX*g0gE쓋nU6Nfɮ#^=mi%;`כ{x=JBCBh=3iv!5_ڧf3E[Oy y~'F8 O M*QAR)zܨ 0 )ݬDU@{xnT iXkyQ6tJ#r9%[K,~6 QjՔl><Eg (3vI0/@8Z6*#*eVC7ZMhD aI^ٟnv\Q/GQ%:ҩ:^*m;:==mſ*5ABIuٴAf"a.@o*\v6c!cĔ(oRf&479K>hUD:C4Q/R)^Np>Lq*jXOU2,X=|K6,Ia n0!>;+p42;BdDۂj]0vmrMT@*ӜC۟gvc\4Ν&d^"ʬ[} ,HGXmowsJ&S@ԅcB/D JHf :>5ZuPsERƏuɂ;O$Y a5t;~H&1XrBS>i- ^h7Po]3}4=F;XH =ostGX:GucAbn0NMԥdj ]miujO]^x|MD?6{Ds<|w^id6dU#Zʮ@/T<M=4ͩ[i@g0q Vە l|@bAJcn}N& %9ꅲ,fv}/~h×䮟{v8%ʫG:HRQKiq2%j˥|џ GR9ӥa~)?ьjKa#+y1/%+hR^{$mHv +,vyQi~%x;F8@hkuk?)NЭ@>Tyu~jS%#(5:/hc̈ I $_80(5}%F3gWacr5 h;UR]wVzJ35o !xqc#q2ot SLVD$tS}7<h9tMYVeC1g,juغϹV.B).5*|`kusiZh_e;~2wu!)ıJhpZ_Մ̎2tVpKh#&*co RLʎ ڏL5NU#%UuЋ!+YVDE g/An U#Gf-n*6)<ISZVRJi#EÆ-AyH+ نik|`CU6F͊ԬPHѝPH&7)VCXY"߶ !ۥ(d!5濙]k0hFYŎxqw jKiv.]L1@#.RG9z&Źpfcj[?^tG-O?;|wuwi b3W#ڧ&ک0EVpHWм^Xecf]&ADp-܅8.YRaZ1qs"tHA<(KHq,Us:;zdT.yzsUcOv>?.|F'HCgFF &Vdٌ#C'z&^zg$܅55&#ABc$8#pV* Qor(G5A =Z#J{ȓ+ TM2j@a4=FvDB7ﵒlfID$"oz,wRpڏ;յ=lN{!`\D V#C.\M҈WtUņ~ߔGՌ{B@KO\ӸEb#Q{x0ji2$ uwMeibJWS*Vf9Z>1J5@Sm,b2TdDL.2 vv JӖD#!CrX`]4m"k!)+miډw+wxxyP2#>3)бH(ƲBeq\euQLtoqGex+ycR~j_ R+S*?\e6%XhJ57XlD`fk/g!Eƕ[~/鈢ϴ Hw. *e'kD0 MbrjQB=V3vANji;r,qɻ)BcuQϷ98;|,h瀱w\ )r8a:.ɕ9;NTU+س#!tn xo"gЌ *?1ebQ?Gɸ(: w&laU.dzׅr;=i :NjŪXK ?3Ō;kO+ԞkG2ۋ2 ra弰{*nX[ b&8Pyn`ÕOp1QEGy^L8λ[?ՖK  `=3AS].3GJT*oqu 7 4HXALt혞^䟐zc-Ƃ=^Ʃ..KSOah)h|iO"Mf6`/?>/ә{cl;6,''DX\3fԁ'gHxibdxkE'0>s=Ȏ.YwU n0FOa# wfEoH nw$t$Hk SF 3xIFݲX|8,hp Ǎxmw}㔜ǔ4 ?VOimyڕd1 Y2 W`` S.sƓlYT9+i@XF28FM$qY*I%@eF-0H:x^)'J)I)񛌔+ 9 b? z*ȴi$BfpQMۆ{f~ U'W5|id'M&hC ]b>Mv+>{Z` '[:FZq=C.3!Fi*a`AͪP0P{P>0s$P-_J+IIaI ʢ :DHj##BQ@({s.蠷t" b;Sp8EkH/KY@Wn5!oJ;ƉwoL 1Nj4OtRph]$RPQ7P”b$ցԸEgd +X=^s$qy5?$H6 Jk+=? b4 6nT+فp]2:!mԗoAae+G?oO8wMa:tQ2u*]T krFpǸ\0+Is,s7@9~ #N0O}>T;?]9v$b٢ 40G( PzPq0شW-ۆ0-<95AkT鏑q+~ fVZʍ` -+^Y]jx2pb9yG48„*yiOԿWq!.D:Ue a1vcMб-Vz:S~ޯ4ot`HVʎW`c$u32wN0|k$Y;hPS>OOh'\iy! M%b<+r[__=C|L@Qbfc \׮ 3?_b8vx19cs,bV0*%n<8t'4Lתn+=Ϧ*( 0Hfa'zOܟͅ VˆNR#>L-gQT}AB벗: YI\Gfp* r זywx6@4-~ Y81XM0JI4My07Fp0ojBo3VߴօC/"#q,b}L|XK]  DNܵ20AS:d蹘XR=mn]$OׄqNzjjA>)}'w"MȗKW=!d9Euʳn}ӈ޺.e r"%, ܰzbѐQl(!zjw]5%SfhR}}^E0ܾ|hS;%qvh;#f ݿ&XDr;A4mlWMD?EeW$|lNJޫLW0 48IZ+4d,M6!al8 Gpql=V4hI;zE},g_p\hG=&"p> [O|[>3W h/e4UZxN%B/`QDo&;3mj3|؋ LjJ^[R)6J" 1b![7jRO!՚ܔHGVӣ{֞]: ,֯n.-x;{aaw,P}#?Rxq99`$OS/o!qnt \@9M.am7|EC[&M2)?({"lI+aWn'}{ҡ#VTiP؉ Pn^z]Ԗ&5L|-o%v詾Q15E%~/\5{0e1#CMgj{`\ҽ0eQLL w7S䔂<;1٫h*IFջ u@~njg&F^rGq#g=;bAx u+` uxȵ-CG|Hz`H>,wˌ|KHI?3RtRxCޅvّRBľ $Zy[ ?xGA-oM2xIyg{7l\GvrčkYg-[vqȎud$ŇwGӁ mMTCw;&wݕX̶RQXDT~n'_.w`S?BTZ}n|wPiwQ4`RPtCv֒J;M3(067-TL :h\YEm6Oͳ㕂ˁZi^ +&a`#n"`#ί2Cݬxa{9n!C2aS4ISƑ>B79!ΡSh1nor6(r_ۖ=NMx6MC%xg)`]ꂅUxoYH~'L52XX$,,oU鲗!t̤cGOJi+Pex$ /!1r^LzЍ :ɱ'6ma)I_ߩ~e;B]ZW[-1҃&8&{o_A t 1OkmF])a[PB'{$6O?ɚ'Mp,M͖FZ*{qyc7j5nr7<4yFm5P#3|;8t50j]ο!ip|g1bq\d3bU=bڲƓԠOkfGU"'ϭQeO퇟-C.PJbeh\rWUƵ0Lu aRWn '^|T"HhƱ![0zM##leJY0#B\؇KTTzAgt3BvTvi˒4$dtڙ؞lW 7\H}\AS>o"#c>-VUDz'b8. ptNK/u=t](^H) !0Th1s1]~cF<7vdBmC?Fp-67|@Lq\E*+CJ93f$=^QRf(}'!6xW!b-{L&\J#1oB!wÝCƓ'BB`+3( I1/$S͋uyೢٱ2I )n=Ӫ(7*qtL1DG~l~+(-c JbKkAڇչ^[͎m4.M_ZϤim8tfAs{2/i;&F{3[`(0l-;9 rgqf&E*]b]MqT}|yFͿGgaQ_fbtUkY߈kV!xidcH)}!˩\q||@z\VN1v?guMj =`O3 *g9bԑ$$_Xog \CC%S{S{.s_bJw\XܦˉQ[ FЎhWY{} n)Tչv뉷 ʺWp$&%Q#onY6a&<+5q[Y1'qkEEYE.x~b~Ӛ̨4-d̘c]Cc At@"9my{@_<)+yAو̜c}'I,RqG{/Da]'//K%lΟQ8c.N0FN#N Bd]GwkQN$3fXd_#2y^ŢJrny \]lDw b{pڶ;>Bc!) jVdM`\XNhn]MVYy{`&ܫSRпa,d395&=hw$J!&7})WM&;SBz2OuD?s^fkkޠ)fpXÆr)'`Pq7Q zbEKX+!3qv{GcpFV2}S^>σB$ XD d Uu#LHhѹzjHԩqN*@; ᎙h5jˑdš@멟n{" ;Pv?#D%< A$$pBu0OǕjO}:N܎H#[EwT `Q"D:B~hKyyH@i\95C V%tsպqCDƀ4|i`.]^n]j;co'_h+& %tg1=~C7?MаXh$SI'ejieMnU?f) l)bun4KN718Ϟ>~LBL,xqe{yR8Hɑ\|~pHeƀquLΒdz;0H4"ңa" ^%K*Aܩh:Eq"LM$_'T?ƒi=5?fA&^H}K(A#AFר'O2,C41" p㧌Lc ؉fdzF"@~If B_ ?tx,=ZdNQ6;8r\8ñaS=AD3s% iJLL+UK|cQ*t4Hd7ÔECR$UIE7Ka[<3םJdah"eBVO-øL Gp C a(3aa {WN{&/&5EB%]A|x[JƩ -&P2ǯIU7#]q$/{K=DF$Qy8.ua&$j(巒D]=;DfX2k%ul+nH:]w} t.~@X][(. { c纗 LEx1Dq(AQ0FcCImWvV*)D,3-Pu壦:# yFGrx ŀmE8,2mYy^7[K`pdK>s=BUcQ8qynVvo]ha8%X ocu"?AL3 !,|^lLp*WP&u1qO\W='V ߅!&G\Dـ=TS|La@ͱu l`oQD/'>oc"ғ57xVқ=Aӓ19zo9y`3{1s'c5df.F Iz]IX[l<3^8| 6D^j q6) ; Dh%u8 HLv2 |SOa]mQ u5 CW>w,&0>(f$6=$ZE2C1®8Nk{p8 4;Rm `M[jTbȦo='5E0p 0=ZBCYcÖ[C9 sxFPoT#:Pd.*2 S. ?pUjgNz3fُ%TZB=pzrV0zY.O"qp(ib7x$RGA?H$Qh ݙ3X4 P3dzHD`Zt)XggbF^0,O^uaI'ětW7'ߦsDL<~ d^{'VoudljϕFhiZ/lu`x}eRU_h`ypokt~rt|jZX8QzTeByzZc=}e(d'yρ-,2EuQ)|ըfK= . jT'hPO*K̗(u`6a-]7^Ts\qp;2x] .9/Ryq w@:˗cZ2!f]G-厔$_֫ Ir]}ayj}H]U1cOEL34k@I AFz}FlpdCz1v+ d{LUEw8 ^?+L$x d}e#EСXC\(Җ2qtUڂ6xE xœʫyZ/yMAIk4Dהx/t i*VK͔<)~]*CҼKP}xczfɾÌk3pIW?HsmM/`,ΦdD=*cRz\oׯmnt7#mnyc/$LnGK]IqDNurd50g X]X-m%=U;SqO'\muzpdNmVstۆq;14QY U<Ppd%ŕ啃o(U7 w6Ah8s4(tn3Km(n'{9rZVN-ҞIxVaB,(;9NN[].p 6:*Z` -ܛNF 2=>>Qv~ok Ãq&LJ$]P'yF:}T~ׇWE* pV`ut Pprn'^sfI_ 1σe3{Bg(w r_%*:&syi 5]9ʹֵ nNBDv9Ql8ZhpM}̻n)Dr4Pb<εzx;pg##(szn1*e T*)/LzK%7`xxbHIxΔs|)aJZ򋥺>[ԷڕCJ&)^VFUXuVst-8ͅ+/fuN#EPO䕰.X?1hNx< v#ZE;@y祴e-jWTql'c$Ɏ"AvhВגQ[le3½G@Vt,-`\>S&5 bpTwWM-1u^ʾ;kc<.AS~$_iplwpL 0>jYu[BRZ_"e.j} p=˰=)gš@"( jn M3j_Wv#!HcjkTeI^AdhTD%bNW(ڶvYHd0ݰ{8RQsQ5e@Kr]@PcZIF"g(ԋZ$< 7ٕ@SnHoBo$F@Pp*)yLM,zoN>ߨT7mB.5Xd+lWV:6"n:Ni63#E¬3]6OvmX>؆[aKXCήww_|ٸ֔Z=J<'9\&)o[dLe Vj]5gҕ@â=]\t޻" &7m:.WDh l'Lי꼨_UJu:L4K[ԑ- sy: UakPZ*zaSfIS&Ub:N 9`?PXI[~&a\D>e5c u_,.ZÛU!q@۾s{)s8rFJ:xH<֦WC!\}Kl:GZ@﷮cR5E8qn`R# ZuyJܐ26T ^Mei._&l>r@]wLg'r +χmcnG[kODX띴޳ڽϺ3r nb@7$/m4R}<܆KU, +Y~q8wvf1Tp\84 ЭYr}ՙ\Ǚ%@5BBvMpvBhPO=}Z0phzT,س~[ v*"0<Vt4L~ 6q _A+an^(mbg|eʽ>dJhҲԢY{ưMgĝamI#꫄L'ϲ_p:o sa<~;Y㢛Vzx$#Zn^H_nP ߛBt0`G-"UGI8jk.ğ?aZU2v5Vs)8uҡnTw*?W;LlNt0GA)=h}1}L  bt eWqzޱ>-`=;FAssWx,]\C?@z8xOZe, sY{*7K"7aYVz)|" ǛT:# r$?gҠF_sz`]ऒ`-,>z)$I3'3խͷ'۔Pn\} 2ƚ>Ds[,ɽ9 q882*dqUEmG`0IeB=bRKOI|Wk}5>L@L= 4r<'3u*.I[N@>K=6WħZsH Rs쬓[݂?,}`A$1.GFٿɼXʼ]Qa63Wr'G/ZKb5, Ёd_%raB6[T{_/A R~PӬrMth9!}݈"r)-&y% 7v ͳޓ\@`#2.ts`x;>עȵȫ$H#`ֽ1ԁM|ބ-61ƴbSp9vk)=o7R>l+Nxnd<^uVlF;-g3'SE;ɀpf%8w‘G 6ċ ގ!/|\=%0 GT ksn,Қy.jlZdI@א85^`LM{vtQGaL~]% t5qZ CS_rg1AR)s+FiOڟǧ5+5JO#K@ȳ's9Jp[j,޴O.g.ȳ`pB1o?C&CT"N'[ֿ`e#XJ=ѦZDV(oÓLrHdֺbr:R Մ킚 [bVy]6. &~J-RRzmv !oDxVxZǤM\PNri~&+-̈-KSn@zdv$J^TYQ@DΉgnZTCOsA 5HFcIRX%71mr*9(32kobeú`h6+sD0\jhXso,R*=lM@ ۍR'io#6IS55jqgD<]وZ]E&^1Zd pCU?.!Jj*>[^Xz)T:vRY`VMm7\ST6\zHM1铒j8pwS\9Mqa4}Nzp#Z<~3Ԏpm-8^rzZkyoг]q![Ek{̮=]딬N]={I+֧H"/$u$]~`rJ1Ǯ٩OtVD{d\n*\M"^P킖Sߵ3ɾ$-vp b @]D}F}Ԑi]z8h_EPisCr3Io Pk.L#4B0*Wv0iHqa_p2R#/bۆUݔVfԦ=N\MlBF `TBMV]MS }&4/قة%vcFz45! L^eG7Ol2X,ƞJe[q-_"6(XTLygtkdw?y\s0} 27CT3c92f\4kIN7AKrCʳ H n':<Ȃ`,^ <ԥ#5W[%! M9 cc]kU;F6'P^\6.փ$$*<'^yrvKz%+qE>d?Z^Q9k:2b. EdYtV]]&>i}ڀ #$D#Y,}Bj%J@XtBWCw(Ky6)pП֚ 82[ <#^WcP!hhJJgK0E=DJu ^*WyPNms|f4/{y Q^?h}geC}vRzg.ѕI59%[Mt`;^v);~"2#x)5،r8~\g=ecAApN+#=podt\g'\um ۙ!ʁ'HC7'kRnН@b7aQWu{oA]ewCۂ0 .Rʶ?Dfc`ak3Gݕ^-r0p? $(w 0YLvwv0Z,S,r S)`w2YV&UX|-w%JK%]˺l]inx)VNEfS@h}lf|+Ռ҆|5EN3]tMH}$sz@џfK>bFuh.myG쉕,9Mh */!+e,$s=ALJ?UUZs\hog;?Ü'|V|u:HusyZw|owZ+}}⪵S/F9D>Ai^9ĴnxQ& C4񵋕gbispuO_vu/\%fOqāGOU9o9Q? U0-y} s yiUv7NnBB(3^ ܔPMG|QԖӁG *OBҗ~\脷߇h:&1ӣ!G_B^AIaG ޻MP>g0?Li wp5Ԃ\Hf8$crgH#IwDL#s3 K\('L?{1 Y -1c?O GMaSNKS$*yTS!(Y",{]HtJ`*g뀕lˆO%b%2- @ }b3H ͖+:  f[p64L3,Cc~t)Hvh|{mI^l3# 8>@2 D69c.1|HqTF[bNvmҌk .͌-Z6&nD)*Y fB?gQdPcLJߕ0WZ@99VbJwsI*xFﻣKw/q)6/z>CK;ґkA-^9Τ,j[˞zWf+[xJbYmm[|ʸJs 7~vo9~c1}nLל t"Нyk@y~myjwVfeTjʎDZӛSE/=o?%vl4IJ}9Bezs?v_ړ'CY. B<ģnO_6`[nvkhx`WɄ[pWh`~D⮎DYSL^Y=bV0Ĉ)Dh=*:@@滳+|kl#2u0Ν{ifFeoϹjm5Sb`k>_" ȓ-"&F`o, RṼW>p3vjXŀHeGHþbiuh]u<8AG;z - KAf:ӈ$y$# UIK EZjOKQ>*fT@R\'yD`4 I$3Ვ"i.?Q\}9􋄒Tծ|{(l`WMhڟ#Έ:O.}%&i -8UĂ_MY`$ zWr)^ŠCη-0\ͪ)*ݬ)d@Y z-\v3$޲uGGx9"ۿ=%۞ǃ(~` $i鈚-"bj@\Qm ')pl2zhJ%&#jLz X]-bNc!z_R4)D\gA@ĝϊͼQ|H*xXΐaB%=|{zd6 FHg!(z-WQb=\v#oޝqކODH$ji$e<~K ?7?wMvQuB`0VU/7,z @3k ܙgbtSl[)`0RGŭ; W&:l  (C=; g: S>Eݒ[hOQ%E(\Qa˖IݺhKd(|U$O<k ݗi.8B-88e/>qKE/L5>`'Ӵi.CV ?imLՇɧz1GءhO۠.[-`:'!?*#t%ư]?'N6'ѥQ#&q+jxqa#yui] ǜrϯ<р(L[헱4}F2zr8"ƂB*( SIsdYKd)=2H 'Kv ~[I:Ȳ.%.[bVY,ΘH24$uc)I -nJPͪR@Z[pEJ,X U_F vnjyhZL`*>ށa{ɲQpͤ8!-4!1 Ԩ3q,9k 2a{Aa{A8l 2b( qY6c1RΔ^p* ҵX/zZ[12 Y!eܚj`%?Z/A8kx6 !BC5`j1j>71wS쇩Go1?Τ[@%m\pV.j\$ WWdTѹ0}ޚ[|Df Xs @°__ZVޒKbq-.J~i2[lspi.}m;vi79Ҷ\wiZ΍1חf i>GIMHFZ޼Tk%FHcARw@^sү??֫,[vnnUm -ɖlgOGo(9~觧QOɧ^ XY~F<t. Өi+kQh?,\'4 8>' ]Y ~O(qɛr7in!e^v]䰕R{at"3Cdޓnsdi,@,b3H$Edg^RLǍq̂ !%{2K K}*7Zsrnjcc nlo6Zlu`TD# a#`Je6:9`U 9=]LpΒۥj bFUtȝ%.Kcdl-ZfFSOh4IEhŲ[v/vKҊadպŇ]/ucNэxxh¨Jg7|o"Ƈ}?oM th ճtqAc ;&y.(T^r)dC6qb2j ,L`5k9Z)Z-cc"_`jt2T{jJBmY ʨJ2/::cqIq-ڻrM\.qAcK3ؾFӍ.|5GYfk[0 sԔӛh% K{Ә[(Zh ȚqPҙ7ى5Wd 1AWQ! э~eߏ7IT|;E=|=nSLKLU0,7흣 k zP7=-!{u$~$sdBhCZ+L6L|!lw)+&l[1b0ztk zU<{N 7׌)OsvA |y%[&>Yܟo0QU3Z5_[0q-E0&Ҝ]saSmaNB֔:D9=QLk1Jo(ux,C=:kS{4iQV%Hop:@r}[*qI εMQ0V:sؚ)%}5Ūj%?kv-3/UC%k %L~eԅt%/<^>n](?ٿŗ < Kh#u<r/r&('Hf,} y6,j@q\N\A @U8v~IfJH_ }݌6ƚ6^Xd,yۦ-hvlBl,wbgMu:Dn=OmBuwt(: O_Qm*^W ڭJ:w?9םon~Lv?21/Ru!SotCaL1ML~xY+a=5{y]UĆ @+n@q0XFSm6 H(lg삗Os lD׮<LY?Jd?|xr@;v=䶑+sCɒXV4y^%{jheY 'I/Qww'.")coNK|b,LKl KP ɪƖKj7Y(SYkhru 0j7rs կZ+DVT¯瘶7., ZzGg|3 eUS`uy]@QW>i;L:dMѶE{|Հt8| i]}0Ez4v<ة+CG ڳa&V*p6o!Z<}LpgEIcNz*6@yJ +lт- F6]YZZ0G1eA] J?ӡU4j,6aheGRW-fYHq.( =xtU5Ф"-L# 扬:cyc@O @ 䵜b\4(_zWA/bzMzTˬ#\}O1-GTwlp:''xs)f00sC&:__`&+ySFQ()H@o$TѐBi f=&"^DsͱjLBWs>c?s&;iX5%ˈLٯW7$xgt&5g']MySP&Uc`9GsLM? $$ubEq1Mi0J'-?ZAE4ִefQ_Zsdd=S ڎҿP 8XBU*~Ab`4ѷ5wywPB]-zdI}"/PdNЫE1ze! T4EhEXI.["qd fSrrDsR T;zgHDG-xXͷU]FqQhٱM%~ejT@BL{G߶ oVݝ߽H aUibpz9'Cb ),ﱕ7(irP\ohJaEtT#&%Z5P'z_*G ~iUWʿLNHZ=Q)ź`eGG1H i6Z~H[>FZ%okR-st>I@%u8^f}Ʒ jd8%pgy{B~M;h> Fʜ9q"i0-/ku2 uy8A p(zˣ`֐4!:a{̎С;g8g"I,F,ʩ!80!8/dޛf=k&wnb M1̣> `xR%R , kCV&nn܇XO;4ΝUcepޡ~Zt ptA':IUNX֎`kvgu7^`-l7%zrJ[m״F*#0'mo)ifA) #3bjMAEV[̹tEiDwui|ƍYm2)tIJh]XkRά:{?8r'[e}q2/1>Y3Ht )hLxL\C>xJF8 9>1h}˸0Z֎YJWe^ &\*i Ca~+ܟyYoQw)Sk)<. \ǥqZ͍\ %C}z0},|w&pMW0[m{7|U<~o2ȋY~3m():%}$|ϽFM]ܻ\\7t3 XjſW 5a)V؋pv8gH*V+>q0<3>gfU.V3[xd۸B6g6(Ι3F#\U5,V;̰*?F$؟!Q8Y1oۆ|/{Y)YQTڭ/:pqS~p PXg%lB^;j"Sȅa%F" ߸(c[Y,5"bˬW=cV(d4JeJW=vS!8H/&!fWv#!CqAe7!e]"Ǣшt;GwJv𛮰K(;H7])F|Tiǟd4?C(*`@u;'5eB.C"СM@СGzjSB`TP? ] >0TrGMn:ܞ~隫vpb|{>T<[IFBKPD"xY[c@\LR { ̟oUrtq g(H&b5B6;)UgA9[ ,olnYE B0Уz\Bެ)eR BAɠ#gvRg#ppJW_ zKҼXEk_c'ˉxd*=2`L;/w'$(._7'\qd u®l4l„cOۅ|1YyIfVk>!Gߦ咯27>+>t L8&:\I߈fnGY;AEc ~0 |7Sp'ʷ$}ҚQJ{E$Rs;)}% b|HɽY*x "Wp7y/4pǗÄ/!I;آ 񣘫')mg/? qfO?˜v^^^فQx-K̐G}.r=KŢ3hs,ӗepʾB6/4?_67GkprjY8ʸ'kD݃LuFE0U\Ng'r.^DC6 =_$'|w6Bt +7/..`֮w^Aբw]r.iJ>Y惀QsD@N;.lD Qc=YOyr`ڐ~zCɬ!ǤGE3ajOpZbXxI'?C(>̌z5w-3Ȫ((.-0+lL)x :H{=*4DXFad{.fAa;5sP< -ɤfB@:]BzL(&zbN)*$]T(9y@9`2c}b V4P(u@}WfWS"(HVu3EjPv&2h`Hj V/)@L xJ`ӕAѡ+B]X!T5z 4w: m,HP8]cxp6()r=\RĩE©œ©tƒ7FY=aSp J̑F+*dgO蒅 6Tk 'nߵ ~~Y`(՜oёh-WW~`v1KّxkNA`5{ߏGȪ>?1^SD3χ;WA() jbP`gVW/o' so tьoԃ˴pYdHNWx"@g'x HU؛Gsr.FV{^vĵTZ]3T}}T0]WPͰh EмHP$ˆ%X.q 1}FZ!?#tT"Վte#s!.LK_ƅg,Q |EXK-q( ~З-|ڳ:b{\2Jql;JtO]jF 3P޵P 9נ<2F!<`5:@Xr(И0c,Lp`)]v%XQ&,%=bI!B.r9.Se$E` o(q9 !kGXrS Kz(ƥL9JC\F,|%m}@an2CCXnf1&-}VXfJ͟*KT˺6,l;ғ:.Ķ6(iwӓ'(rBPByiZ:4[%AA: +8"G%5[f:GN֯hqT$nݦȐ?,@A o#yR)ɥ{[+#c$+>ZIQ4Z.MHxF(e@aNIe֦\ )[L7C^)f_ M=GY" l.1}W ? y:0%4~WJK>M99QNIeG'p1$g|`x>t]{z_Awwhχa8j|'8%S ;FLfC%as nx2aH7Ҹt%e3t0) hm$(:H%J3(р.x3 Yc0# LkỄ;bL&D):t>_HLb&jx3piT@Fgg 6}6#z)ql$ ꘕM뇱^<$1Dasm&wYDmSXB֋xh-&0sdb==s1XtNђB|T5/G;YcC@ 2N 8*9؉>c+Fx=i d]UsB ڪkWZluiC⡇j'%*)_ [dޝBq_@u7IzoWA+AK8ML~Q@}/03FAۙbA4Eѣ]}Yjchgճ\]ޗm]{{XPy= N />m|\Uw ޱoŇV%jDzD~/(:G@*yY2P&ظ[Fŗ:^a"oH{[6aȖ:~o/~fFX>/n4͢~bFkc~60Noкzh:(i?Ϗ& CrHE4/,6RU0RJE^)`fzO?B,X#C$̔% &njLm#÷e 0Ѫ~dFBʘpAΔK4thugbS~ esP2:2=_k`h3Qŕu%Ӣk#з.^ڤm| =`Y.P\69u_cXva$K3KF-e6t3 P瘤)_$( 7 wĢT,o'y1@4@yOʑA٨S=Bj>F?3''cIYOcY)7I םr/˜[~|өoVL1c/ 3NXGԊ1!y˘X#{'T0ši%48{e! Yd0qd`8[>9Z .-t$|%hqycI3_x&FŏPhlyJ!%.͐9AOT7(|6d p!}0i$Irx+j \_٘F  2ci]#2+N, 8uN%tDbbΚʆ*˙? [IÊhޓf %cD'߰^ WqX%0K~du@S *'K;O @^%{(5Nzp1x J`+ ebq䱝Pt 8cӴ} PZӴhLk_Is.tz:׿@4ml#?:´ԟwYB"Fo5F?^)S<2gl܍koAh 4\[#0fN>H4Q\@p$N@KХ#H_i., pG"7a_m` \BM=>o(YIM,HY%e)̀rKRs,R븺^PtCܽ>DĘ\w,BC(&lgS y ,'4Tcl&rB=IӞ=+(V-3jU5KqD4S2p,,bI g vdN6lnd!oOH{o.#rOˆu-Le{ e_ᥙ@D qHW"(ٮtg-ڪ\0ή_~Ot[kJd̊> ׺{.5f:FyCPΞ ;@j,#n$K6]’Zӓ}zGܸ$q">=V:'|/,#4m}կ@O6ʮcI3>8C-sv~FNbg>'}9ؿ7Z 8j?ڣ n$l9,g(qX"Ν86uG~jaČdž6TM:ϞP]&*(Ƌ#3oeֽZ쾩gQM2u NCEyj \wztXҹ=Ӛ:6-ca< UM~aey<9\|57'"XXd=16A paYޕhitӫ'\=Bb ]Bb{AA ]C]ɡ^8G-QK i7?}֨DHQ8RZ&K>I>*V74QWAۅ .&/{Z  K߾g\5I+GL[#%1'C~e"eޜ̉JtfE.()R-Qej;os<&kܚ 9]] Ӥ;DlNy & Xw'w>"Cpݺ\ѩ asl+TѤ q *T&96]5F]v 淪!IXM@B|9%ͩoP7,gYTG%kÍI4>B w7 +Kz]튘(1g)+w3WʎiLxOE`\B+x^Wi{,1-iDTJC!)SYݥ$Hd |̆צE&x+MtZ$(r> !\_`06vـ:y [9 gY],ow#>F2-ٻw?|S5;|/Î:{-f5x~x}K hLC|D,pX@Iy|hI#iX} + fN~ŌΠ_t3xz?(xP*>mȟqaQPL_C/!!OGTHL#,H }6~y8CDm$G$Ӝ ,E?C)OiCX[(ʁЮ]58!G 9u[oXeB5t۵%ʓ^~)f}M_Dq^'h+̆[HCppp%r̚M)?4f:cJxRL+ #&n.gU[r68{Sq~cqX֧ڗ`pfnes< d5!kH""rh3k aQ|d$z%&1w>IKՙ]FLf6 two` #Fwj;~C7.*r]@ov&=6]ĈVKv(} Tz9Tɯ;a\tΚ$\v@>uӦUbnb%!KX2M#9U68d9' m;dP}4*o ͐7ɧ K"c~ٍːU 9OFlE}D8-2gJYx~(kӠiX˲jAHSOV[ȸ}A toSQ`*Jz_5G,щ݂k !Z fwYsa[Df!SK9+_fye.L.c#9͚SZ8?|-\MōiCzv́F'#d֑7a(B*/~:j~$&0~Ң(VlCWPҘb~QT?A&pAl"2/Ԡ&} kȇ9RN&SهCA?`8Q?P}kTׯ~#I){NG +v:c½6gz4}QJ eap髻ZF7`a=1u}pu'Ս5ш xc3Yr )/rLS}߿:: ]*JI e Ç3zx"⧪WTw ?>"bA I*q RK_b$!߰uC1V v!kkd awcŨ~jIU\ZtA7µG{c _u0|!b\{.;kؚk$ .Gy" Lݓ5Rk%hnP+Z%Cpt?=r < ,}[^Ӻ?-4DXA˻5CTs)k`VQOsaX[<&T#$a?J?M#:tӷZHj#*'p%bxjQ^h9]j;b5w!Ea ui?3*"xix ZtNë-nKjXyëPZ}G/ S}dTѽ985еByq<[׻I!yS-X/(U߶VrAj%a k@ucE*jL^lfWL YnNkWIJ^:yzI $j7UB"[Ni|jkzV{Qۋwx8W0hsnTԴ8,ppwɎI#kR V,@e__^GkT{JE KJo&$WhC-쵵*ҹº '3*msߎSgZ}r¡/zA1'H\܍xhv&AӰ5mY]sGzm8pVĨ0(lG(L HwDMy)}eIk,&mAkT7q(& (X2b7-X7ӈ(рT$j*a ٌ,_ڇTL$3 abAdDb(*ej Q.W*q1Qe{= 4UDl*Y% ƛԬ=Q(BsXTSZĺE+(ʷXs35(v6Ѥ"-\'Hb]EE CRnΈS{-6^܏bh\)$i{SQwUJ1K 4INb*R Ŭ~f% T.^fRE$6t$£DZ_,D1?-('],ȢH,rMi$ۣHc<ɞ&ѫiGISrQJқXB|LɿFt }%h NOIvh&@(]4cN 8軮X{3yx*M\ޕl[\O&l6A*bH>:N}pdt0iH"3QHL"ׄ:{Ev>TvgtͅE1 UL:E"bd*5]4f_:DH=|/{ Lj{0&t0~FT1p4 k $#H{G[EH$ƥ։݈}z5=vA~zUNŔj]?iM2V8f0{bfk0y9vػgk>Dꓗt%䫭t7(PXH`K,-,3Y >`Yoh.[ĀR)?%b&bf1ӃMo "U65ʞ,źnFm^nf{+'D /cjN]swrPrh|Z (;^/j JiU>ž~(>KMY>6U 9E# ̓UƪIͮX)E}F}ZS(=CtG 'Wʠ-E'֞sˍ"; Ҏĭ y*T澈?T݋B z>HHQJҨ= c]P C_yi_h(Dگj.XV,BFrYV 9 zH轢3R3DopEy#{3bqRkf 4ύ jsK ^020[[2~@WH*rE? @ ;B&b G/ 2 N֕Z쯅)6o<%:ml@I6RiݡCru%& jX4![tp:NNYe$Ze4@WG%N(O˳tkyc:NJ>y/t1&5Tc1R6:@{O̳%? H |3'̍A Kr^%/Y8OofQsH`ӕϦ 2!BҚͬê!&FBbiiи (TOyRB*v H`d* 豠b}T@;KCc ,1sEdDd^I+tuϔbwE&G MQG wJюje=Z,ɦԊb?WIY)Ab!W4#5.Ux "}F=i&:MF-/Ep݄ ϥcHPGP`VaXnhJ` iP) ?$f2>FR%Y>Lw KГ*" m(L-MIEĴZnfd ^l0oOreQTBU} 4FKUdIeNKkĒRI둠T-u݅RwF'A+4XBW[h(n\G]l;HK_GkG+) bٝ]djۚn-"|TAYz*;FޘtGY$Wo=&~KE G\Aw0vSR~}ڨcIo9hһK\V2`lsy_ѨZ3+,ml# X0]FG h Q @Jb= wtMif3ĶD11FuFC(HUI!>YO约뺮F b^>nBXC(e %P`X;0 ` LǑ $2]'Xb,x %8 X,XL/f\ ?"Er̖paP.2r\Ga%= bY%l3.E0c,33zE锑Q E y$6*yיk$0΢`-$vcM<R7Z1z{^DId 7^̆Ej=JR#uܛyY6a+ǩwY>*m2%ޫP;->Ό?:Vqxׇ=q8DaK- x:FpK w΢;\4.ëtx]p wB2U]ݍ?~ o"󬰖]hڋ8Koӷ01mlЙmu'n7=WZhE}f=\ DiAY-Ʒ Xd0'9j׬pxpztƟyU>eԄrOݺpKo0{ZC&X"m?m=HTcic -6 T!,)bl/"D5@W+"oIV#*R<`yqPC5a j3y!mbUBAhij&?qqAIGY@F=i⊡CI F,'`{SK/(^/3yYJn>Ozld;}vz|,jZ= l`+: 5<>i) uB S$7S}Po xȏ^CQ Hz,xhe'ԇ6[Z\B=jk#?1 ߄ Q,4d9;G`i1q_o<4y JQsm5%cG aa!j\fa! H,4Ar#aR2NJ?pQLqĠFrhn$p:՛DW yQ_ly$u5x8Eз"#-8ϰO Jѹ Cy3bfwP@`{`8JdƙM‘eڱLUߋKx4k}XV[Do}X^X\DsoXM,yIYvE!.@{pnW`:GڲE!OT@865tfh ~{bx͈M3_b! e; 7)رVTa},$'IRꙶrvYd:T0\ލ=D&K [}?S/)f -Ь}f&{j,FaS#I|F_)xL7e*oRm?p wͮ t'+k8`w ӲU9=䞉A,bi:Xhּ$cŏO=~`t{!gI}&IҧZXF=CNkJYYyJ0T1M rYP'ѧ߆8ZsbG8?Bl*܊nspIJ9'OT+TKMbt9e0h chb=i{0zASh])<~рG 顣9P)HeƢ$ufG0Jʜ\IʜVG: oD…$!;oæfrʼ3ҽW:Ig,n 0("SUI>nͽSH"9C6]cUc&-Ai v7(-hT,LIt5Aź۳k30WLM 5zEbF< &2i*L>85j"aI HkU2r:+b @lt"Ń X`(jI^Ƞ{:+4I=@'͙t&.u1DXF8XS+T uNV++^T ـyaIp Xpɸk{ƺ3ђDƀh,^PL3XLD'%h'/uu #Zf~oLd.FcJ(2Q+]!KH0@),Q q*Ұz!rJ_ ! 6u9U+;rf8$@ h@,fu,F&o#p\5;8F>>-}o=]F)1KFSXrgr}@irswΚ9i SMb`Y=|9'm7 CEL?h&YFt@"{I(Jي1Ce?8|}.R([3۸ .z_?bwn?o"n#lz/tH`w`O-|x)IɥՔMB5>ԒG\$U *r i)jsu~ֵ6mBFMب*0\7P1\V&WJ3J>Q:E=XQEʰ0gU|l &-f՝ 2˸9aR6c};TSP)(tl]܆ꫵGB*jFɩjbUdzC"dso\cu{2c =ԠegB~ȊԱfʑDNbC}k6,MIpx%WEq;6SJ5Lt?|E ٳ58I,p^ss k" sM!t ҩ<ܐ Pe7즃 끣 f& {iPH zjQ9[[tB ͙Q`ݦO 8%ƀCuvruoP Z sD`FRi81y6m5084ْGjMye͏aTdϩ1Ξ/xHh~CLQ'i|N|y*nm"W Xezc>K>q8k66i~Ƨ Y/4⸒ӈ&=ڀ#b(,bz148R!_^`eg)._^+R*4{_o,`xF,3.)H: F.,%<3#QصH&NI/ $ -^¢}gBAcHZ޿)Fezp[}6柍ZKiK` 8݊Dڢyl 1$vM-XIZ@{O$-f ~#\d!RQ[4H z 4},O ;|f~BD4?RJrMs<_BQ#'CcG%V}Uj\ [ mX,Rl~)K'G1+BPBJ,7ۃj|5FQ5 5UjUK$#h,(ӉWnjQww]_X53k.yidžd{JjSUA hE?Fr>D[y26DF~FB$@ƽx˨yw8 2@Q*rjj-:(-~];3 |'}a8 Jq`E*"YutGse0X",K@LiK Q|.1ky60\I$N ,I0ߦ/{0)NgC>3yI"2 oR`H3r:{P|r"Qkū8R4KQ;%cb ,T1&Mvu <Żz@X@Yz6. !)d'nTż {%`yw%R]C3b-iyaK?]/CaDr KhȌ |~6mLjsq/z p=؃f&hZ%" ƿ5?*IɂS(!~_`ŲY<HH$2Qz x@p+IK;FrTP@qK PkSVS-΅Iq̄dRם&C"|yIATIW]ҋDwSZ~~OR,FR|ӷx ?/VdnzloFؚf%SϹq@MX(/.U֙H孂TÞNǜr9@>i%6f +n܌ 5D3JJFұa\< o(vNMej~=d昂GB0䨃8jUt+YtzLi.'U3.Oe`h&Æjg{YwJYF305^U?R}Q*5U]î(}NCdo1HCv אKe bZ,=:5^B-+$;|_)Xc R97,#\^\wߤOqw`x 4gZsnʉՉ9Ѐ?BiruWΪv?U:A7& ֶl:;^b~ {RޡAkEyv> d.`gj79ȉlwto QRfU%7 iS:qjA5kAjT>BnLODiv`oد)"+ϵg6H50r-eBT2޿KC֘X;eA6 mv(=1#0P1J9B9NZhUhX,6bIYȄdM* eBBO/sd8BK! ШoTW!&H/.1j):I2h "byqآM-D6V{:o$+I59KdE"!4"$ȟ9ዚm$M{D=_7wg6 .Zdh6Acjw ^# uZ䛧6X.ˍ`ff!pp.@#$vw*\tGf4,LӤL;3Rя64Vب4G%dK>2Z~i+XwyM]TuLf6?ٲZ8E˶n?r@IuJ3[ |mk q au[g,|f+]7ݨWV'~MB??ˏ-UY7L)K ȥ~*{J^޺i~(6o_Wy3ƌ^\}_D~ƜB Jv\wT㓛 |YqrwmNWo|F}pa77榩NzpxۊYp <!4Vى#!e awd1MxdHȤҤ)v-<3+m I ^(ݑu`И?q$r]j:ɘ&d3R?4I`YԺyp5O[ XIpAg/`kS Z6 >d<_`33z6` Tv:$[OIf[/'Hw#{ mTnikLrsna}hl@˝Ps$+vNfجMX lsj$5.v<M ͫ2X?<t[A4k?ګ Kv^.0,7lj$H96 P(m|?cFP! 5~8<|klc<+A|:"9aiJذl^TY; ŝ%*8X˕ !+=DRb}D)=G_(9^ݦyc1ePi?swcA{fVZlK8G -2Fv-=Ѫ  #F~:vj!0)kO;bmXp<Kԝ4<z)hYv}1io}QߡŽ1"9PhNfZu NV+xnLhA괎r;d$Ծ#M`|A^C]8[4鳕MuW=\k -u =XO*{'T#cHV"m3xTn[sMl~:ya)!D_B;'ydhIp-$.wriGƓ&K5RA6HznsX# &*:Yhyx_0s?/잧i5fdMaaaqehg<|NA}bP[PÈX⌘y 盽Xc cY4X#4_dmSU;qY83 uW#cEXG< Xd \PxĵT _EGXM [D3A>ym~y5^fWYÂo mb겛KB.65<;EbwμPeAqͪM+e]m1\ =iV& ko~,HyQMv /pL;i(4[JG6Z(haCZ $Lf=bea|\/ɓo|}ZUhF5OɏڒJ3f KPy%cm&&K^Cv q&hH"kgxy02U;rnhnmG:uO3Q|ԫ ͱ!觱R* 2D~XI^KqPG ~R`48;4#4Os %_84jCckKU-]]jw݉lHX𜉗}N ?K %|޲̐ ex\>x c)R1U#S>1:%eȧ,lЄ{4Xwȗ B Cמ3 ,v4 kh%P$grn6Xk_6=7 {{1=sg,h&bE8/<ɂFϏQ[_Ud,>``~ /["@ju2O=/]FGr؅)<(c~kcHR*6L*kw-{9Yla0Ny쬜hdpfF =TttrW[˙=GvbWa~AǾl*peEiM2̌]f##*M|#\ AU!ƹIn \XsI.ϯa 8[,eRtrYcyWyA`K x-+$ Ii S(kA,YZOKiA & 05#50[odd#Z#9 ۼQ÷CWT[Zy[v.ihR EMq=B,/I?GE{KRw>KHemwԸNʇH n>rܜ3NoHrY *lh[,'X``w ־cugAXY9fv1.&1NNM-u4o;mIJ Y3=}5=q;\3pNL1q;1_JC&]H `Ðqfsm'j&(12եdgtZ@=w]e0Zbu%ݏf 5oR1A љG՗&B%/,>TB]ѫw Dڸ?FdՐqIīDžJd8(ަ^1d}"TqZDh=\|3Sy7a߇OmI1Ϡ]Fd=YX:!Ż0ᐿqlQnW0-/J2u ' IkFB!^8!ה¤%i5-WXUBeLe=r(<7Hzu(ƞ9Y=ƜbsnLuʡj#L_A3qJA|:͵6kt(Měբ.Ñcq._׫ߒ W!w4}'Sc6!1R6jYy%:;UW/u/n|kqK?qZCȺB,QO_I?l} )7a2ⵐ\ӟ!Hat7yH_ @: 7 y%}Yny\(k9bQbciלʋI Jyrg>Txy|3E9\e?A,;zZihtmǑGPy ē В> xcCH>F8ߌ8g@/b~%&d69P7fL塚p9Bjhd3w+.*w62 [y}:y}^P 8E* 0 %<lKѪ׫/$a. hm5q t%%c s @N1 <67?AnVgOlj[gAB7 `a$s]vǛ䏒H=f)9Cdݘ̄KEBWcהIGJ1WެC%@!sx%KyWdSwC7}mDTeIE*C9(K]ext6ͻXt}OH>'ﲄ4cm7x^CBeDzܮg ]숧)"]q,iԷWҰ0WcߪH\ѠECN-T] :k,ͳC+ݝwzǪ-}Oh5ܴcЋھ&[K쁅=0lW<:CC2Z*gr']&`} &unhkE`[W &/-B!ycaJlǸ-U}/V:B001LFŠ7r rC$E]H!mԟQVUx 1"*~F1eoe._zcNґjw`{z!4r yR w^>26Y u]5-'Jz"(A]јh)p)8sR$(&Ѥ3r>{GH3iu$1;ZI .3dBwdd($/䥭y)ߘZ[7ׇH{V4ѢM}kGlqHD79&/AU ' 0Қ"_5N &WS%Hn|ۑ;9"8I~' ?gƖ8v8kxXv{ Zzqg^Ms9 n,&rTN!xcڧzȯr~ uZJ@M`ȷuP毈f/S*dRpfJ(Zm qA5;k%=9xRx6}7 T]+ʸu"t:j ~͔} y RY׺.^ *f 3cqmZU1*ff'k L3MtVgp61(Dq76s{!՟&=1z5OVݠ_K~0@7}Q=h^- M@M(մK$-إ0ۋF4A! ~vaWr#fOBET^:SkE߂Y383I-, QID2Ш&JO<<҅2y'U'^Rv41Bc ؇om't/ i!ȔW?lٞR.Q<;XYs ߌfss9^VK-HJ5aXR3җ{84n2Y"_<׫܍يD^;9*3%dZ |K^}?]4Ɖit\+fB |5JX'=fꦪ5BAk|.RJN&QZa%4ܚ }RKJo=zockK1Ҥv%xUh 5ɵ€ıOd¡UlqoLZCS:6Ix 'P~@|RI'':ĀH{S9u/qU Z1qJ9 9,f1$q>鑂1+:&zqST^ dZE;z4 Yc;R`%is 5frfTLC/it/Y[(x / iKa9%ۋ$myU>7+1A{fil>HPp5FeGQ 193::&_3(3"ƈ}1|]ۚSH=wS4u&ՠ楙+KhO O8rZ\! i+b-nILy#vF7eV yBC43kQt{穩bBׁ^$( c{DI9qDd"Xn'Ӻ~v%p?V;IcwHIδ2J8]EPn Z7vcs)b<( ڗi}^Gۈi+ ($I)ڿ|uH۹;upFЬ1kqEd5@>r1*K- +V 4!TU!u00L"OQͲPln WCt*q]ޗb׈/iK܁ٛ&%D=en 'H hBG./eއq2ܖd0[4|@S]4*MsѴ(h횯&zDh#"7JS0 ı"ZAΫAG 7# EV ćluL Pĺ j ?A~R']&?(ǫh x;?Ko_b=jީ~8KrwZђFY`GԄv,AnQj7?1q=իZ\UY<)NXo<:\- dy{=*GWiOKg DoMrCC8 xGqL2TXxw3K \%(|VÇ>Jg VM"d׮pix-xxs5ɪRq,qGm )T8mUZ ҚS}z$5w.'ZlEwެtF6Ӑ£>yHR~?(|B eUzQqRHRcGtsn*re/XN"g)W޻NC8i r5!v=bC}W$%T1峀sRD"%9;FOgxtw,>\h|K "@;-xJ4W=zɣݫI6NޘVn\)ڞigqg 1|؎ buKEn/1f &RZU}Pq5XtfMߖ%b!i1@>"ח2Q}yDے**aDYi:!w3R f?|G?ޫ q@W HDtH -Ҳvam1 $2V^aSo4ًڎCtߔHX껳)=2>;a-9ۘ {KOGABDW:B`>0+N~=X)J>-y=?8FMrݤes(ⱜn_,i jFZ0H٧e qk bV>[n3i taSNy>,&2Զ#${1~6\2 c̳qp~X_֜춲˭Ɛ{`.1h6^=I_čۚ15aXܔb弢‚K,h.f˗wuj~v/ n!O<)8 euTee?>*T.( Je9@1H,ev(A ~| g4trxz6DmB'yZ\u30<zS]bZ+$ڼT|2 Qu2)8Ț,M=cy| 0^߶ͨ-o($7Y '`t L*y 'YYsQ.1FQj%mi7}]QI{nZqOJ$Gw'H^BI Ѹ#_\CN0[mqkꔅVc(G-YUZtcFEك1,84[CJhfq}~&CIH\w,hué KǁgÝ%Zw+O~3pVQT$=}md4Bv^ȶrۅsZFWdi6 g;DcW($6t 5\J G.d=d-ِmr"8F^h|&80LJ8o2!pڦۄ*TTW> 8Zm@R$8-yưozKq^-KXrס$Yep+ݍmFNYR'/RD}/7l!6UwΞ~ĈO5`QB0o^}bSr+5TbQ~`7vKh35R\f^;s zP|`O`&[HT0<s]VPžw$840- u~{PBnYz,Aԝ I7([Rϖ#ğP-()q#RUʧU!_ڡНP 8s(%W8,L u@–Df]oץ 4,lKm,ČiIGY qHwu(T8pb\ͭYM,$X ^k<+KM %ﴔGB}U. }m!),9XvXh%F˸oDѱy#bJ)Ԕlz0վW -EufaUpcrf:X%W4[> 5.Ր{(Ʈl32g]$3IbZ_Av<ܑKNPRN9T)I Or>N*h?9V* {sFZ~ofc~Hڶ\4Q.48Tv-?N?Rr#|MXRnb !*J n6{09,h6x0[!MBaH;5=_emrLR\] `0e | *x?EeK@̐V$7ľaK\^[kr ׭yhkR??tFtL,59䞴G`l6AVOh,2LFqҵ2Ef>T86EWt` LV3u^ LA0ۘN_$&@A.ƒt7-< /]$WpK-q$ αha) u 0 aAICYbh&ۣâlu} jաcc*lVZCօwosu@0:]k_n9_ګ&M}̧yz3w3HTYmƖ%2;CHl\x:h"H.mkղݡZCiOG10qjMЃ ńSLMP ׉1"f9[eZ܆1cyUb)1fs`e% Ulaj&盎]94djjIEюd*muN T .J!EA &T[1鎵uru)yV1ŭL*^miNj$)!v!?z'Ih$EEswoj5~"=ù8'GcR^$4W0: 3f8\#դZNrw1Y2ė|N6-LNuFc'73?Z07J{z T~rHo#]=1ҦddVMTS5bnRU%m^꼠VX!4+R [ d/G?I:lSӬ$tIؼ8I8=+jFj, >GL=OH>4Ĩ%礰.m(րs@cκv-1h_9l7|ְyz"7Ou9Y!\ࣩVW]@11h)I^n w\ eLXM3A/䧏?ah;LUF-5B#̈́B| 2cr_t}#0,9Dߋ4a1,rp2c A;^N)q늇ʵr$1l$`_G}%E_̯~L Z<`d/;k/ʹc{gW ,}H}Y{=J} vDH\U|'udm,PUp0; q^O?>7Bf+Ũ%&kEB˺fZ^Nֳ|t0P*r<|2J4/X\̧yӪ9c03Ezw dlsw= 3-0o`[Wp&OZ (U9Qo9d&#`Ji"2ِỐW2ц4? G[ei%/ 'y?~%QLȽbH#1|1+edcf3bx3Qs,E >B(僈GY=3p S%+yuQRŴIT\8#dyw͔!G=:Ң ,oE& 2@xŸ``b:!߀`d,Xf$jG|"Rl.!k,QasI0UXOU Ԡ&H#ǃ|YΔ?X6 ~!l2O+0ՐukP:x, dwJʌ`Vsݶ4u ,sjsC1FfGd5[2_ 5#~I-q*`Jǖ5nbchDV8jvzɪi{q8޴aFheL-ܕ0}0~ۑъ G|C k&k@}sDA:;|G[1e$?Ž_N`N@1 mk2 o#  sHq4epĜϟI,m=Ѱר;˂7)XƏz"URIr+ ~;ޢx$ fO",q~mv7ӵ `;ؕ2ʯĚ~CZ\@<Ѝz8HT%Nӌ+;v._F8`ޢ܀oR@;yg>|Hӷ{ Xiv+$0& BI bNMg!(pr_N"ү c45F3ϴs^S~ӯTb_,ejt7Wūq$ϲNzϲlyUɘVҲ[j- G^fM:!q6nɺ6iE,r8vfTUoF3 ?n2vRC}ruܛ+ ]@.Oiu*?uIF!^[o\Ts*W.C;ɜ-+u#N;㴁=B9*OF|eFڳrl^6׹i^U 1`± jv*{;g+s+|۟!f|$i|ڎ `P4iApgMBho?%J-1_ȖS@SqQ"0Luqh%)7H@!ڎ m7v}b@`?&:{^3)WD1͢w_TSɗ;f2jnq=9Kl ,v'D~`/:y* OL`үP dK*3}je-7r'LX_JL͝|cu$^J?!y8kwm^IQұz]X2o4 x6t bzf^$@ViE>$"@](-4}1Y?J1TLP, S&|FhenPF\X셹]e-Q?T^l[Pw;~D;,x!hōyrK"F«ާBof,,0VWV'!'ϬzNky KtK*b>m oKI R~>߇?48 om,a5"t |*:s5c3U5OJuܨf=ݥ젢.r f4Tu|'Q8;[!ȆVy]-9U ?*NqG,LBjfC gm,&naOX!i8;̝cwa ,тIeҭ5fdq#Q['rlrEm6D-̚-[]U=iZ l$%MY% 1ːPM%AYjZ}M#%&MjT?֬Lh͎i-{y MevT)8U7"lbc{dȄv1ݬJuI..oh+(ZY|mO,Hl̲l0kf P]2 MS*[([Ƞz/ ]_)K#N=S F5)ܵ|a|@n%yz5FHU4cub L8SKUn\yYC& Y8X 63z2TJœ-i;u5[Tib=\$`{ !<A)҈lndVlWfmSbfi)<\}NݘdSPV$͡фXJ+"3ND)`ו5$hmuğy5wI?Թʩ˥m[!:.%@ZoevۡH;. yO}7JJ٠ЭV: E)D')Vܳ :1/7" @I;%"lze1$:)8}?y垤&Y 7"$|.>`2t?< _ L` = '#qF}LXGdLٰ71^ͅn7RCfSlT965]4B RpAh~d3: jfKxn!^uLkf1.K"_c1$73ko>+䅯aj8߈ϖ|1AuoSPm ky/,/x~{EXݦɑB7۔.nI3֑:KϋqeʅtEQ"I)˓cF&NZy?rvQvN~B$f5Wz&ouhѾp~}N̡$tڅ> RytKPE7"^s̈Q`Rz^qQTR(\ hrVBE|pPf?1ȕ-uravũ5ֿ!NyyGg.Im~ KiFϴ&PprL\Ce X ]Ϩ Va[1&?A/;Lբ 1gSc0@d%|&l1sRʊwunm}E*dAk|E&#HE] "LkRfem1$[SQ65bMr/GNR9Qi͋E%8*ְ [pCᒆGb)%\x|%ze^F7potTJ<ێ+lNU~lԵN4ǥ%h Yzj @K1*pA'<ȄGD k\d]nDdid &xh@I%y1Ν8Hvk63RD2*" o 0r9+>W W}̜Z1W)x'۞n'0O,[^MTʙ񦶈h&1[D-v`#u9$a.5}F{&d?{j1 m#o6}N'\qjC |c %R*4Ϣ.L钕>ՔI$YF1k-/ tG{)!esK3b/یhQ^q YTC Ĭ%JY`nCb2zy\Qt/65Y~K-3l\+ &qY+n3M)HrG{_ 7DCL[ؘ VZvQgT5W)fllwhI}ЏrtoUSB&?]5n8Eqm~C8Q H`HdGeXtz]CPҒff>PkLcfl|JBCPe})xQđ&-pE(FІJ@V*87\wWK͖(:]9,_rGDqrjW]TNjP,A !>hd_7^ULmSWjLCODr sҹ=0gc},'3+n-zF (=LJ%4 t+r¢X!$A#$J!=H ׏L(؃Yӟ ZB2-LnúarYX(F v n=U,NEvb6'48;}Ob Y)a%PCPR=ͱ~g"n*A:.zj?DCK7&)!k) PMS!K-Ҍ G/ФS?7ϋ"IB3Y_t #Ç+Xw".6*q@]D|SΩ[_ZR4$KKШ*.M\[@s/8xFA~QIPHUm_jޅ__Ϸ$a:>m}/zA ו,0h)UQTi~&QA.n!%LR\}ܣ'HػjsnYv~-u'0QܑJ0 )hAk+uF"=[ء`\)(f86pz8R^ 1EyvIBvzzQgh WghD.jtQcME1SBR.φ3|5څj5{"#U xv!ds\j#NW웫=Bk :<)D7od^"b:Q򗰏T[5 `"2c%tSo׫Ӊn,Q=pUwMm *iG65%_/u⛣LfpV@铆qK3#jF3RBuc{4NnmbsI%\NA7Ql[o!D>zfU4kƩQ2zBcXI&G6s6P9Ss;^Mev2Ptkc3hT*IʪS]NHߚ ţBqɀW2*xKN\ӒM1{ݱa`jjo~h8￶9>,U a+› lXBNA[wyi_z;k1%an?hp?::Å,6`+S4+DeNYJ3;钚f4v-(6~]QO-mPXP`U4꒛vҝ潶&g-y z=#㊲X$g<(i3ԒNornTm~5==ӵ;c7lD{MZFgI~kTm XU5e;Q{MRJٮ 3)d/2֪4mT <Еmg$`ke_#iMZ[RmV" Pfgŕ05q&"F+..6zwAL[FX,ɝ v&2䩗=ĐIw]`_LG+0}y80ey#VeZ퀎ߪ}+vQ֫8ڴE1W2<3D\G[FԔa'v 68. B2,g3rLj,g 50H~ێ}w\u:SQ1 =UjW\4Lem-ŨeBDJI{Iشo 'xSb@h-OOG, mg@6`9t"D/ӁZ1O7`d }'|ap_vB30w,KEo^fʗ~u%7m(~QOoOL9|`UFT!2d+N gLnY`@iD(4N*)d~7~ OUz+- a fO[u46)D kRAuPp8YL|<={4FxF8g2PG@[ɸO@u0KbVyu?IywDwx~c*AdXL RԄW*c^K8uwe I6<"ru&xmmcP(In29V"S3TѥȓdʟLOrVGPq }"5#z%RJq&iF8svNRa&ʞ|4)D=6/V H@;8(3 {9C8ŶΈu8 g{ŦDt1*RWw*hKyv!eDg8RT;a3`e{u@ \ 0KV'N(mC\ZNemLÞpFB8R`4x~CpI#61eO"@8'ɒ5-.|$"r^qy Pn4КQglmflQ3gОArzވ;nj U'hh0 ?<" 5Uc~A;\Ҥ.`;o?gviI9)T(VM#~cJ[l DZ!W9r!δu؅ wpRa=S Hd(^b3Gi.}NEY٭ ^{ew6᧦XE9<Z MN9"\aO{eQenQY4~߁WǂE7aApRȩQKDDžFA!oUU l .{g&B'03᪹O׹u5ŮG M^P"zBx[7U'˿`7P_Mf.yv=uu[]B>{It.8zeT)(n4 Ѹ v7\Ϸ\j=PKQ*63BR`.\h]zCLVe7 NX7؇)G\xQyx SŠJ-'񰬮'%Ȏrc=ɦ)z5#qH.`MM*Vl\?oaH,8M62o r۱^cNn\5 Rd[_7|Fy r(O+B|PjX۲NOzm߃]wZ/8N9$Ժj6I8Iξd+@Y檱< 'Jc~fyvо֎4c 2,l6+,+n6[\ & ^{ r Z[YG.xCQڍZyRTOJ4HVI--!vš:8j,߯N~#/y

`shHԗ#ڂs'{-F> TN=x!xMF6Uwrh:n9=/`CϦɓ'Ztg¤'xI70qL\KstR 5[.kN耹 LbNˠ8LʟkBSc0O?;f+).`kR6mdӰE*[lN2hI]@֏Va; zL -:*T+uwH ;݇JB&⺂ŎiB٤,(z] Y ᦀCT{ZPƯаaHSq~h"~0Lg(]#  8*i0̴kvFGjςw2d~ }Bec4E(]sIKF-%Ou `~(LyY: ·zgOD-xO{Uqx_ڹ'ިJw' =g24TQ @%m8ZY8j>Eos܀aMD(jH@Y +ۥ// uo"0Fg_#&DAe̦PAv圕AвU7Tqˎ–ozqc32kC|@;MMGq/SC;\Zʖ` [+o+k&P//m(\C}f${@b#[vִmu9r6XD69qH.՛~w?6& A h WoJ R}[9aPUt8&#Ndϙq+~"[ev^W֑A(4b?iaZHTq)DÑlD]fEP1?@aXiMA]JHZ'4Nv뜧nn_6~ 5zV6%q&F"\M2QP`_uLkiaHrVw VK-]K{ѕs 7M<ߴ*;emwEC'r'fcآ]`ߛ=pB,'0v7 MQ ?%G,}R-:9IUVJ*l(X!)dҬ7|DU`74 gmkGc-T#$<7DZzirJQ">ݲ+>_SV##*A A* K\CKm]NA@C +fЧeMj [)z{GѰM[_󲾺l-gz6^ϙ/.F -f|3>7T0ﲔ\ [k[طwծ^d9oezl/6|g}]1x~tg9۴Be,/;j fgVƫR}atvj5%-9f KUv ruYvk8+춎7Z .OwvSTEڕՙ*tNa:Ygn̋uq|U}«Ko_[#Ȼ0%÷*p! #h>z9 °&JmtT$yBѴ%O,:EVdOX8Be8 Ս!v5GEț0.JR[ i}^$G6Jز@*f@sQƌ1s^p=Gq3sp(VcJ^B^Y_sdAj+@f|y]d50>/ LjX.~maϨZUR" ,HKC(MlHdmH.{5T Yd'n'h.b(Y~ ";rd-]i 1b9. O`1:9}i)5vp/ja &TMU7?Ҵ-A5,o` !)77Xa8bC^AtMʹ#| C1?.[!𘤔}xuݣC(}~Ì'4_zw$[񟍱~KrE;’lO_//2.g R Qun5UO 8hCjCvpE' @c*K?ogNmPqC{_:~@!%jY p:V7N5I(0;5|)LȌ EVEQߣ Z5 _"m( +D˻ij7( $/&9L;ELxT7\ 8=34w_]. z[dy$I{?mK2ԣI0+rAw17vkZuғr]>̶BQͮv[EDMo1 NB?Ȗ6F PC}v,GnIiK"|oSu&xV;Q yQM6TqF( w(fZ?H>n/ڟ6+,lt f"psd^!JdasBpwPޒImŨ@M'{_^f[4vYfzͳn @"ťu(Lj#\;\6qMh,˭/]{-\lRXK@gsSPzH/{"dd0cȰrv4=d5nSkТ¸yE-$kwcשAv-{>Jۭzu)FuSn 35!ͻ? WWWԢsRI}mQ$}Df4׽% ߠ82Ko`}N >jLw(( {N\EKe"9(µwkjCxw]63ݣ-oikl1%_,ʦ!yX-Uk5GփJb$$ bhcv1Ń9O<#kv.9S N I;nM 'aEj4bQdř *oTm? |W [6-]lS,n.1F|-{)y5hm/;5Xma~ RA`7Hms0e!bƨa>_?LGՑƌAQd z,:VܯI:݇\~ ue?UD?p4Q-o/|6ǥl>\J{<~eBAjwڰkgD '8Wz 4(-;٬#LJ͡0QMiן Rm.$~ OUʽe FD %N̵ؚխ`y?S(wlGOI [ 47W></ 6ML 3 :C$ɾs%.F;r&晓/;ԐDqE$$s]g8|,>9,x?H|sK\wʥ0Mrh$88"΅Hb@m)ȾknyP<[Ἤ g^Wđ8R<-&J4sEWP'=J/Փ ~C0%#U3V9wr{  Rޖh;rlqT&wg}q.<w{>k츗d:¨c`I|=Poa'9տ>ڕv{Eo;Ry}TJhڥRO ]jӎxzE< 8HY6#bwA~"cĽ=yO?9%*.߈=~1ØGfXcqL80~qJm=Ӯ\^Hv C0С3yɎSoWJO+utCeJVcvM=m 3ɖJ֟Ro{Sq ~P>*ˍ$9/Hj=I`O>rH\$\nc]]|m#]]R&)߅P]wV/[{>ܺ^#8(tyͤk/Le碌\ -יqWcD7.>ܻ Ǧ3ab9+/[%MᄥpBscrK s瓯ѼR m'WjݣiB盌5d{iDE3}bM)E ,1ݦ9l&]63\Ԟ}D[ ث)vq=On+~ŋ;PYԞ%ÓW 28 IaB oF1MF5usY*̚qB3Niw ZA,Q7@t1P$?>[neP%-J+e #Qig\TB _GY=[j%z+E}+KXT:|?_i4?5ut$`^7jʱ |ا~7+E.3辙Mۅ,[B&$Z)cyRUnjl%gii9''{^/ eLJpn jmxS50gL S~LR Ŗ,rk(H"u(kG Eb(CA ;h[(b!ڗ4Φ0ΒS痱 Cꢂ/RӳAN7 8b([ v# eHPD{BT4Jv&ExKrWtd3Y2#] R#9ê!ZN+CA{?b/ v{ΈO?}1}OEU>ꤵ]x?4fVj"ZoSkI'VeMUOUOmIZ* *UA]?WPt+XT:AkM+)"Pu\k'/ 4#_"pp1x9M]RH]dt +ݡ̅-_9YC$[ŚXB@N]L6МKTjbO˿9mՄW&;)LvQt՝]A36~aFQ嬫g!EޤL(W}b4ե"NEJ$# WUg&_\ : D*z OI剸k}s,ME^ԋ -ivCŏ#Da}hbbg6pp5dk~ {2d_x,:[aT}΁څ>icb^1̋a P+|CV#DGBEmƒT ajkڬ)ݺ!=sm>; 25(х#o7`Ca>͕B]鈰vpJfʁsNM1a+Fw_UfMNj^RH}rN(`6i^xF:[X=NW`^^L-Ϙb-@w[ZM澰AXwY6NTAUĎ%_D[N g<9%MKYoOOSr:Ez\+d4 o]Gڪh} ;qEFB%4ZLL+.SWZ-;N*`97u3Xao&-1䢚VX5Rh\T7؂Ր/|3* Ak|0^;yœ1mJCb2:Q |\X_W+U`P]J%71$VRqDkU-.*+Ժ"F:b/nl*BJL?H>4c).q ~ _k)<]ְ-% 0bBWBiTm7R]5_ ^TbRzL V$`^f_ow&{o-Ϝ)U;97)r+Vɴ̯|-SvFe۰&g) s2&U&<ŹdVEݬ*GMۇMQA/U^_$?N4&ϵ謺9@7|U7*\ ^TgUmU/\sw#:Ѝ]a4Āv+Brpn~ Pw@3]DP'%zЍ`\~qéд37}^^rBVnO\ȃ+G yrp[SiUvZWG6>Zϊr:%Ȥ6lL⎠SS[ PrprD;uݨֶtͥ~sUKWх|O?gZrߞ19ڭ\뭺>Y|mBFr2֐ MmOy$Y}"/?D:Om~Dgrzx XYƏ JLi~Oxc˸i?# 1`'U6eoR*hWA7O򭞪5Ix (; z]7SXUڮ/!`XAcٷ` \#ct]Ł jXKJ^9$␊>_ lK,Iᅲ_o,DuoL V}xӔy<Ⱦ9J73Co=^Fi@ACgmۦu~/&i?e dTkxa7sOwx4)]Uc2ԮJ;&X?HaZBn;.J]X'|G3ﴖx&Buhb-5##Je-H hp%12$[maI]9|H@RC X#`-[DR/u*VpBXA\lmSkk0KO1'(MH&7F0maHxŚǡk@ ,>guhU ևcg5ucnׂlKy44zKđN96*aZcۧ\7 u#uO' ̽=`] bSN]Ӹ z+Mh 'ۛ RVymzLRp傐w.$BKȯ[L[_7Uh΂:7YП{HD@>r¹NHE*!37Eյ~Th,϶BP`+BhJ ێb]EC4`c.3a6Oܜ%hwdM͐LtA9 E~GzB gPK4؈,J :IJ[*gSK> uTݽF_?ē15vJQś>ok2_$[Ezx@\|z'X-c vx%.qh%р~DȔ2pb}d&PSH$cw=q875H- I-šk5HWNozH3"RS9b[u8zKF"{RC Oe0F=pS|qwPhQҷE_X:4 yf͝O#Mz(5 X\gWҨ%ЀI")5x,}~sި7?=<GfV{Csa4kuq:4XR2Ϡ}(ťg@@IJžֻAy0R7"ScIS Xy]5LЛUW J!/z+%*70\&dpn&61YM|uȁ0Yr`foh`@8zjLwLO9>@Gݵ.~.8&R ?ؠ$_M8ykZ#o W%c+ Q pj+_dK a`H>sV1QόsŖ 鈐:=8zW Uy p𴆈`DYZyb!" JL6Sh4鿴?Z NȔxd "TO%lqx:*ag,+iW&dqk#Oxf m.H 8Fu|lrXZ8&{[ XзQ:[0kMA2ZfHwi/| L\ ="&T5B(ܵЙfRݐd3U9]ޜ X5j9JL[nof"75vo$oQ@8 u8LmT,W-?$_$=hN>RvʌDt>>yIy!^L`3J> Kvͩe8,i@x8 p H]N蝥uCP G_Zo" =zOP·ݣ 8Ъc9A4AU u?sOJ#ap_La·;6D)Xg.267RJ۰eIϞY[^=xRzC h;!]9?nMu8/.n!_n#?oFASMMhLcj6Pr-7՞lL7dX^3G/^{B\E:iQ0~q 4*'y~v\U=M4uŒ&-o!kF`CT ^'0JCq~$"1Ć$r["vQMEnTWhLMfqn"罴jiM?D^zjG gJבؾO  /=elVM)= 5wDL-Ɠ[ T:YO͒Rd2I2$U17ȅA<'3 4Ex RF;^ShQ B2iS˦i>TTht^?-ށLmYI &|&k`3Թ`en0=&MjkHZudeOXzn*JMݰË:'Tik*4:`& i\P= ]5 ] ʲ%#R9"[`0F;쀑F0 L`|YQ:pclH !JQjj-=,\rh(NLF1 !E0A0WP VW4'8 u$s!/'KF"(6_/"0ǒ= k^>bc0 :+!X9C&ɢ)>.PY+KoRS."x.¦sWМeU͋'r_7dIG̛GRI/PtϨcÚ@¶;y%1 3c:ʫw b>?y 9Ԍ|[w沼31k&0-II+@H#ɰBo#͘m˙M~ [">U>C"j@4PrӘLyȅı:>rCY4D(c@ !E &D~Rce<`~O*fB(NP>+#,Do-}EJ]fbӟzhHcx,/@0o¶$nIqڦmVaDj,S|FiJGh.:䂠#J"s{фZ;Y)[2_Oz*SXkMra"|fʮeUBiM' Vpf^`ecPY}"%y-U۝?@ "KscECB#;f8 ڏ `8%0㳂Y$}91rz~TX]P8jQ٩4H޶2`la]r{<Mzu&!~JBLz'I\"0G&d"w9*Y+}#݈xÉ>,^3S%p;k2<)kNI=uok~m4Տ"ƇrK\;'2f&=8Ko 7TJ u1N٩q3;z:X!t)$uBHڂv [RP UÖך֐/ z 8{/l#R FKT@Нq ŀM0!)ZAEPEIs^-\(pmrnfl|;eIamh;\G{BA;sdK""iR%B_h%Vܱ\^tnJTpu|iktL)n χR4nre3+ Br7cǩEiJO *Nm*z%tXIJ9JaPQtduc+GAI#TϨKXK=bhTQ;/ZIy@Mqa`|^Ψ>V=Ƙ%2i̵<^&<"_r846]F)YqTaґ BNgf (b'gu1,YMYUU+7GZL-O~ynt!)  ćGd Iy.u/M;4ۥQ`L'H|{B|Me}OH;"ڄ0׫kƃ۾ki->;}]eDfYNGw鼼]I ä~=U<* &+nzsB|+gw1N}ubVo# SnGfћ貂QO~JIg|kDq"nm3QjrfUSX:Lz2k3-[5}]П$L ұ =$0LQ+C":̓8tH䝴Dkfkz'^[?ٶba4Dr+Ka"H{=i ͨlr|vF:>lWe 1:M峓>LT_J,5p f[#]mS 6 `*a_H@8)g `@ǔ hS]gt15ߏ#S>5:4(dT9t{w&6wfDkZ)n`u%{2P(@ FxDA1*֯Zź0"HB `%)=#s3/[R6G-Q45EH> ^ᖩwXk8+#y{Id^f^&)P{JZnCkV_ +Hi8.-1r\Գ)WL 4XJ"X~E^-)!Z|I2EFYԏt'\#aXY[ i?b#̖semLaGsgH)/LIKny# ףBU.ދbߜ.F>cmD́ԝ_7?ɆS:P[NnSXJ˝$Bi/TvVq ŭ1j\aP=7мğ¨3J\"BNaR|^C>:~VU~(YG<;i :LO?n:?=BV{J6.]Iry;m/mmQ9P,ka LW?kmOdxNԬs5_3SLd а{K S@ʐ4x.~LG;òFf4Rˊuډ;Twrױ[3W {Ul6W:(3z(;zQڼ1M;!eZB;"΍/[m it- kh{,{ j^95<%M O|hyBUeivbV<Hh|6"Df*4r^.鼞a㙴,NZTxowx{q O̦f2Dvlf[ˊڍ e=rjwoTdyT)k=Xfr5<"p+1FHFYj{,j:z.Cn61O׍t 읣p<{xuLZV.=QFӭ;hލ61Zg !8ϹcAsZ}gv6:w;hgh&ۆˍrk /* { (ԞĐ! CvgƱp $!\F'0L2pW]0= `w;ܺJ )ݵ:F @+ 1KIP"Z7/RMpxeߵ?'7EvxMb叶+}]ncsRO3UԮu|2:۸hnpk}jcAb)g .7b ٟ vl;L$zc.ӣa$QI\7-obV]g1=**ɝʠ @&-8vڮܪ#C<s!W,R[( P0\,"H7%AIH Z51$(sŵ/" _#g!q짛bveyo4&ĽN-.QQY&AF~SY-jv$A}B@@ZAs< uV βstfdڋy^X<gc@hOr)D-d[X^o܃N}v `񷄛b6YKts꽱mϪI5?4[]5u{v0ٖլԌI+vIUf.HLk::&,g9 CqLl%"D'ޔ._drxF^|%*[e>#yF+dFf3KvF "$kqEB&-ʵu|'|&iY!k9Wr> Uu_ۋ~icI^Om'gl:,gSfӚKtZP!9ͥZ 9绤C\0F[^c?ҫ-Ir]%/P">O}n")r: Ӷf L奐0'eyOH6 KGe͆,?r%SR}{r{J[{K6Qu6|(?Wf-j%π$A6 eM v7}p)4;o&6ۣ6fĐϻ9I#GkvyHѮ]F[+~|(ֲ7Io1f2n |>wdK3ᭅ j?_n018ч n>A]Y+GNk8lMwnѹW roqSƻr-"ıy31=>^Ip{zEO2Bw"||XyLn4"jh[i=Ga>K,›XZu껮e-H6"+wt5y<ŃROq;OǯFM3њEχCr .E%P2] PLnMIOO]Fs֓LW (H/!c(P2h:YUM7YX ޟqV't$"p%3sySsm b]5|r@nG``ymF}Cw)GBv7qQlZG= a]up8.01` hP@A*MZFawU#{;\/qT3Ț7[>N.EiȐ([U3k:)b2WLB( !ߠ]eJUrp02`mHa].|#EQ0fsrN>mt JTnpTA%?`[D'eƆb:<őt^/pP w֣lq:oa I%s&оjA79h h)G~^A$U(Hr 3EcUc /,E@y%ͮXyEk_l5\WVK+ lN ArKk> 6޵*Z Yj{9L:LԦ%M=+4!%В(3Q|'V2Kfհrl[x%J͊6J:2ʒEROQέB u%% f ?7p[2bp7Z%A ]\|$ה:&Jk>]ϫϪ"EtN̶U7ڹL\+%.* e<V2r,i{ѐ7m*y ؾ'5pX[87!{k$@Ŝ.>+X `>3Zc 7@(2c6n5`<9w!0 ovu ]۹93`M 1406 Q-.g:51dȃ *'S5 ^QL w/ŨNWqpN-/?>nG& o-/>EeD06>vA CVD2z&Ţz_>;5[W \EnN@$wП\ukW870Xubz_^ɞ6V\"B ! .t5u3:GW|(̆@Ez#:mIxޗ 9hERK[fdxfuА?^C V7a8^L,9*KNgʭtnw aR|ϵX8 ]_;W)" H@Hdl:-[&v|wyv5ve}AVЩd~F@V& Ulqv5 Co4dVvZB\ɵ :GJ= J(>/('wҒSMyobpjC ߠ7y٤5;(l{k',:SƵsL] /a}^R+I޽dG~zP6FDZD/eL(H8j7л.ݢj'5ϴ5rFN9Y,e:CiSF` ,HťIY@"Dv+֨JEgh^$-A(ň)|72 ˣoHw<mP qY>.rɵ#ǁܫlDQe =O:Е^ ^*% {"&oKP~g1Cw3ixǩl&b݄ 's։6c׌XX<s_&2T6sYbD  8?KB5'ɏ0I獴 $q“dCX񐷓7p2 (]7k_Nx~nՃ*^Z|x VWCF/cيxͶx/34vT:Z[qΆR& +A$ІB~jƀ6Ahݠr!1a&?IX;UAl"7I3 5<*.vDWpaӡc~ G= VŠx#[ V 6݀j6HbV~7=DVLzg0.5 q/E/3fSbYws߰;H;|GQxP1c0ѡ ʬЖo~.`O|a9m3U*X p!T`Ȋֲ 3-+_'j@Gr^ʙc`啕 ZE+`4 VI0i(YFjk#O=+IGY8&sq8>p\!qeSڲ܉E9gVset1YEK˒d02IhY^#:]bM[[ kzz&?8JR<0‚K>aF:e\LL >2~Exʍ ]"0qyAxkBZ dQWoіk wI?>U(96څBMBVVG7)"t\ T9>chE)㔚O#XˍWk `Th\^Шcx>cܴ?6)^MAŤO;ϱIW6Ht/wJ3tpBB[4KF91f/w[$3{وO*юvْ@bhw;U\,XmMoQ>}{ЁʶL.#[_ڍ xGT/VNuNa_@Wm…-|a@˄*4kAX7-Bҧ5~=.DŽ)Zי^4h_ JgPUHHFE#O {g\[w7 7w~O6ďYCyR snTm~lxreROCO+ɗ+ 6A/xHvqOIgl[6.I:֏; W ĻVYxOu۸nĢKck ޻dGBlY*vvU~kkAX[L\ lj 27rt A@kdFpz*^闌nJJ+T56'[x}{'a n࡚4X{ݠY~z# #Х rM'RK𼄼ثH"{ږ D\瑰x v%ȹ$H,ly} ٕ 3]~CSKԻdB G^CT89X_X| O"&Q'M3Đ<*Ň|EQr }(SI};B~-a?Q#\^zy7'tcm;13X<<52K'Šd3^ DCKc\[YUP dj *6° &rMZW'_q0e+O,knx>Ҋܲ}Yc:Űj>sAK*Mt۵bU?:8GIWHT`[G67 ט(*r|fJ EN)#ŋǏy? #~Q 4Eg(]g}օVl@̬&y]{vDb~Hׄ9S@glQ!Y,'fw4c SǾ?(q'Vr47z\kzىmK>dsc5t!ѢIPy&##7N!|]^ޕ4z~)@ɢ'5[jC|:f $Ф{*";,\n5k\{ahB͛Ⱦ")%fFeF82E!@}@f4|XԜ0A3" p=)*p+o`0Oאl@R?㈞˘dX)sdgriX֣ `,~,;'aսȣvT3zZ9p"iGw$r@tSr8gPwoL QDKmU Cb?mAE,1lH'M:6i̦n6!|G80C~`B'BT茤Ͳh"A'`G(714Asȑ*PrA6H?@}z"> ]|RUPM UZ"MN\A܀'Ug&./pfAuM,V))ѢԲIŽYE " [GiImT? Njϩz󅄬NtX-(<-` T"kQ,&+kGzUOuҸl{]CP7a7gˎ/FQ2;û% ӰĕB&'Bm}]^Yf(?ʦ eTld(P:zFꆛƆH)x@b oR*8R ji("B77߰ic»S[kې\BbL4+0w}! ) Cb4FMRx.*>'Ly x̚ej<ξz>$4͜ qrѿ&P16Pӣ6QYO?8 i. |%d2g`gg4KeB[$~mC}SC)lSJZ0J16Z؉g"̘|*ߗϊV|miטbsƧRۃ;e$!lzyPB|R'[NZگTX0S˾NwZʇFeMX" NyQy Ѿn((Ń+6?Wz{N0>\$`>`JxNhgh;jND-= m>iE\7l3|j}u*Ldt-.^gvz,^PvHCXCo-PjvcET@Jsd~e9"im&,8Qߔz/Ai@ALMK N/beEi*:wH"j)m>2s1шAJEV4TTYhcVe܂Ba Ȗj:ڱ}jĻе1-0šzQHn& hUWIue%H\(ÈORT%FLaH"JF*#21/"7Ug<kb,|$ĥ[FT\j <,|=߫b }=9Ue^|;~l1xL؋Aǝ7eJ熑ipxvT6:T.ěgFP WMh,u8""CQTM3:7嚰w외&\k[\DI&pLR3Si7hG})uw -Qǘ co9OEpQʝɬT܁7Ü- Ē84PYhh%IZ>XZ`)R* o "4M+!gi0mzj2"`"qdc}q;-W 3` R"FQU."|cr$:$$3(IQWVgѽfd>uXp/Wڙ$,1ȶi7lnGbdI2 sq ,X),#a3W36bψADzh| 7Jx:Tsmen@t6cH-~vsz0̯ivJF~ejךF[˨D8NR#~Ev͡(q $r"k;XYĄTӮyZYY 1i?!qew#>PAXUJKcV S[hI*e*a՛!@QƩmRKUMΊ?hg8QYbg}NY?{FɈ>CWlwZ*^5WGGlFFfFUnj TDlo82KsZ5 1^ ߶{^;1!0)+qݸJP {~^I罋bͮޮ!Lfpӕ Ah7 `u,HDy=)DKI2ȓ;RGٗX͇f$4diGtwW-?dL#19q%8ELf1Q)(8;#w -Dj'1:r^d8r^8 tx(͈cjF.>T1B)rIƸ1 %#W84=8QXy$ "42Y+<:fEQ], ׽CaivJ>ƎC ؔrW$]W>p%d+h GY:JKD<2MYFK;G.va/a0#!PZYGх3!󱛎#|WIn }cd HYEjh Wb[I[y6'ĞK S󕈠#$JN#Dk7(P y:<eШ!sY@z<8C#8mIp%4ii TaFDť']oAǘg^0Mz3/>Oӊh4 [C vX[*LK*T.џշtM!zv.y61`W+繚'jY.l|[Rlg/,!RhomH?F57haZ,#z)k_%&xk?\>1⌖NTod{fkuYf66^ .1(sԖZ0C.=<wՊu;g)\+^m4ΔCG {+ktt:Z.Nw6Dذ_6l8t7;l`=3s zY:Litmw( ZIzW99vqeAq͇R'u ܿN.7cڼOT{tq΍ H\g'#wҡ#-Kc} KZ_+hm2l`B( x2tRÓϋsxmਜ3 b^.t_|"Z.Be!"EiVڋxl¦a+Lxؙfq綛]a tG_(8vBHXoY*C1@1;8?f>b֟Eȉ[4[Ev/W1WM0-RnפBS- Yfy0[O/b3cFST\̨CBr!;SR),N{\73%1j X ])vn#'El$ &ݦ^UHX.'?LY (*}J&f p#?h>l\3Icdˏt̯X+᪂N (*b鉹s+ZlWCaJɖ?IS%yqyWc4D놇$n`浪~M_U]?pб X_)tglݑ11=d;p3fSl(hTc# p<"m?~z5Z "7`=.K޽:;}a566ML/W#s0nv^NNZ̖hV/l\ܹ;>- *3 ]fe&Rf嘷>]pv;&*Y}޸U;e |D5f. Hu52v!ҟ:e KŽ-ϧ͘{,D2PbW30_!r6@pxvwT*?iꔳEm2A> 9пj9fBk>{DIZ$sG@Pdkj08/cMԄP#:YoY\ wP\QQv[1_S~Rf!_=m L;D9Lq-7C+ݘ{~ih܆ m|J!-ʯFַ֕x|rnxy $O'[FPQ8|zÛd޺ټD)j Ol)};A y)gFUR܁k-[ul(Eze9Q(ƑNhVI4UJxY-Mu/\| Mvy|@bѣ>ovZӮۨ4G+It\߿\7!R/ODPn, DQݣ`9U~`jTEIU&&աI&bP~g&xRa-ܞ1#B'5=A\YMbF jI]7J#xCuE/D+ʙ<ˉK>F}7cPC~"'6g:6^S_W㑦7#2֗iy.jyj"3}M 6ȣ"&e|끪}1 KJ`f<`jҰ:z2h smQ>,ҧ`ˆ :Kbdě6^&30kŠc啟6nhթs jڊ}vvjIdՁހo >LQE>nw8JAҧs_A(:PT\44G0\~e15 _F1*̫̺α,EdV+֓}FR/ K&VyWY$rkԫKҋ-c B :+W|<"(I/YĀsnuKԫ\QJ3u /$\H5Feݟ_@).9WEh0سZ2 3}F!|̘y+sZ:5ܥs׸):"#,Ausx: O-3NY7ѢN"+|B0XޤCUd̸ʲɵ~brqhN' ̘OMU)3NGTE潮qVrI_/skVߪۤa;OG9^I"Ɖ!i2I; !Z2kvkH쎂f3 3 J!2_M"a]Qj"A2U4ﭡuWSgCi舖fo T|XOZ‡UpAfݎQoT=^9c1gYnGQ .r` +MVCa g=U-v!MvEl{W{ۯeh0yNt/+;&JQVE&H⢨ociԔzyS}~A/"6S䎼{o=[7.QLEl|jeOXRTqyԇ΀>KYETc/5Zy*qp|t7\!7i#ggI x(q|N=s[ʅ`~@u6OPÓz>qpzMQPg *q{|({s^/}s%ҲlBn(m]pgEricyKEGZSP M)CҞ @W#./20P6'C=j7)q[Z6WkWl;o'k?u-[uYbpktylGg]wo崼0bwLQj$GT*yrS2 .?Mo~eބO2cv*ݕGe0g])Tnu> 2=8yp?.[$$\ieW-L i*.bk̮<ܾzLVMMѤMo;w_vS;&\WO~u95)x]&Ѕh כ]Tz]M%˃x'GǝB7mΑ@ʼ8jjnyZou!>zf#uJܓ5 C¥jHcU1.57QQ ܘHx6e;GV'dxg|&g"u;B<Ǽ!>xuQ<7Uc,A"afƟskvyi5 JTl%Ms{d[)<0kES٦v^t!3hX\C% ;,AUYlWZळDk{a~m⵳7&GUjU&8o Q8:fN/J>Ikj@#yrFF.%OZkl:2[V\Tf:,3V5˄T42`V3csK sEԘ\ҹ'X#Fu+j!Fut v-ѭ1z>;#@kX?hA"r*^)Չ2 V\_բ\DV~V.V[ruӂ%df"IoG;O<}@ H<E0< 2Vra/ۖWď e#}Iek;2e@ǭAVM#^gS42g?9\=n9yFĕ@dzoŨ|>,!anp<~==AESZ?@ ޡuFV"7>t2lʺejCREp h Ca8p>ȶkϒ h.sSFaNV{qx(r::ʺZX gGnĐra* "1]puRBz{iUܢ$KÐ^.FF6,. g9;'llϳVf_ba3<в񌛈Q2-YnӘB ͭJ`:_$:&Z\BP]$~9^Aì-C ; L2A78u}L*7a/.M[b&U#}pWP ot.eÀizp$7ѓQ/'}x& +4j5o x7j"ۤEnz,73|uHr8*G޷V-"uQ#D<:Do_nE,r p )K:;[m]_'Pw\XA\`W =zx) W)_|w^p+1!*)!L?}yFS|LgbT|L. O8xFڔ0"P 3ڸfҪ2aש#`dUi3عY-5"@Ы0:$hZ_Vu8.. PN|kC"feUG{O r X8)A0Pxd㰫z${l=ߎTlg6R\%Q Cvbcy#k{qi>rCq ˂B[f81j;vΪi2kQjF3@.džd!\PCs2:(k;d:,k(ߊH"Hj։SjQ&Xȍr^X)jXW,V\V o%<&SI@m-0mY#>Q/;&]5:#l+*n R~)IΈ^'۸ L9 !D*'6zAd~@X ,r^ [&{b# i}Z9J,5iNYe g"QzTUڵ}-7Q)_k.Tϳ6Ђ*3 SPΏ(HbǮŧדL2#h\n!oYX}6NǬ"H0Ԟ0F aՊdݏPNG$H<24&0Wu䎥ݱ3Xڬ\EK2qPތ;2ew͌w48}#2X'%\Hx+{ %6%ÖlVt|mqqq|Wy,'vGhWu (DoO!.Q'po lb(raAvG~%MuV;2ס)eQu]_Cܛ dRd;.2e/98cXۏnZwlVY(̸x7OsZa3,1ŒiJ9|*:y`joFm7AC%?3{{1 .,)xͥ_ذC5djhzxFc^,ò!@ښٌ]v5nմAjNj3g~IK\uILw4ϋr};X),-GꕤrRN^9"maAU8)R4J~l@f[\LxX(sW({~'&~B )bažbhc`Tp&V0 ow}3p&:k!{=Bhk gˊg#/^r&ztF4#ºĺ˗ wP cXEGqȘ5XW%Xyk}m"o mlV:1Fzq tcOTL=3Ax#'b*|ݛL9)\1.aGݩZk*Nn7$:$Z +ـ72ohRu"k@)fBaK`\2oLZ۰3YN[p3|8SK'RV1fS C_srًF\ 趽 mNcQ:[qb|n4v"A7{ :pKܤɾ\@~S{e K.)[K(>˜}qnXnX LV Q'Lπ&5Gv/gK\ 'nsbU5aW0 -ҍ{u8PKyl5~c˝B0}>ީDmFSs{j^)3̒N\misD7^>LYQ[d! ц<+kEZ(TlZUkOZّa?ȧ %.oQI@FēQm>0)u aE3_l?{R8X6WC*-m{{6H=T5_n/9 #"c+GjuA6N"+Y~YBda/|JkMqoS+7]p h&%{: ֯E`"MNH:Uxvx{K^"qWs]hJWx$m[5f̊Wo`,)S`[a}M}g=o5h/L-s)7R/:Y,zb{#dxV,w9bR훵{x6Am F0WBFI$iݘ{Z0. 7t>RƒKQ.<]g/R'(%>b%>\RoI])6 } d\a5bBA*ȇ/yQ..2Bi-j:Er9~sENrGNk ىn,gb׫0 wC(뎾<ݕqڰF8mSW(J6M1Ή3ӜiɌeh2̼n>swxL[[},⒏24@OݧwW pV3v*ȎZl5 ~G} Xg8nw9ELQ:ؾh8/.LZ ;Dʹ8g/^}]-ɒ(*yj ~gUߎp՛t !3ytcBU5 {,i`dHQB&>]zڹNz"$ւSR.Q|(:JX {߇Zێܓ sv!5wqhE.,$ Fr )d03)*e[@EXum905`D(HjWLy> SSSHוlQW u1j&&3ڀ3vMv]uA蠋H+j?Afj!>?ʁQ .@ObdEPKRfQy6D޷_ =%J:CDXn|:څL1&#gT]p[&/N?^n.@4Jr];hNCX~+DOAc3 fW Hh'䞑Y~3fE0-b^,+%\^O8 i|%$He,?/P'IqJ6Am3ߟL^@ץ)P$1!ummYY PT3*'&*0Q9x!.=rR#6&γIӃ>D{!'ే7}yؤrN'>)۟돝|Khyߤ'9SF[_w+41rWwkђfkk5Iz Cl'bn"*X(J-fU\gAMf|bN:ԯ ϴE֍\7f5d'd'ȓv`˞@:G_zb}5Mݧ㉢햗pG츍<.k7A/>fk|۳ 2=+{~&0TiԵPw0DL8+#`-M{xnpRH}owHܿ`nBŭPsK!9 |*E+e[ U[]?}Z(G Hj~/L *\PH%vOlzS=)PY}ݑ D2Q-طMj@(8Kpv;xݑ9< hIS8R@aTINAq2!7-aʬW RCa{,׍|y }.]rɪA"ɬrA<II˫:ui(a]| RA`^q!B{zŇG o0 ie6Q Vy.&Br4)VR'ֳB:%NJMŮz'pڕ]b$yCF9%@'=r۪eD AX7%ӂ`J PHV(J9bL=VN L@W#[)g6Ix wF/6ɯN5U#!N4nBu$ytM'd6+S孲E2 {Muu ~#0ˋ8|W6`sL0 CO&^ q^Հ@@=6jS>mjW~U@}\-?Vyj Ts-xSLeFnܷ'~GU+[.|c l#&z3OKߟaIG_w;.|k L%Bć=Lf4bloH%mwWF)В+%6^a5!(U'[>Cc@J^EĂZHoߢ@e W@@@Po8iiY^t !ͦ)g8 5rHRNr+-A5)1J`d6d.%^VS'0G mԭBOM׀ V}5r=ni _3"_-M6>w̳|e.lcT\d]^LPY7 T M7IJG6EOQ*ٟGsZqe]j-Sw7qZZUC%,ZBt:+/$N=xY6̖v9E0to@+DaAI  gfG/ȗ&(IV0(U H<άׁڌI'@Barg4dsi1}u9prA):a݄ 5R zOW3z |MF$o8) B&˙Fy8V0hj_vqTJ a/ٞ. 9n=/N~HH/A^ޖY4i@XSrּ }GÞYhn1/6A\+',#91ɏn >Voův\pAWuHpo xdkDnA+8k ^la8*9 T:a#ysYrժ*Td[+=k4յTE!LL+^Mvbȍgg&٭j^_V뻓A 8ZD nWDnHW;v#9 \K c=1^R8rpd61"Պ.͐UvNyY2ucaAv ~3.ב_Cl*\\ oex(.-p0rVYkg`u_@6zEQ |?oER7G?1~Ʀ҈8B +Q <謻-}@v BFtu򶀕:J {6jKD4'9$EuFuñ7_ѯZEY":1DRr$G@А*6 u/!( u1#đ?Cَ'J}bl [t "i?X*)0-(jKaƔMn*{hijYu)Ya' !1a%<臮lU@Au!TDR⽲EK'ײr|~,3{N8u{_6%M lMKcO U3g5iud'sI73vbQs8Uǯ*7"I..995MI-CamT2+TbTL`= e%1L Y;!$8B H+%{M(-qƧB*. hqH.s!9y!@tȃ"`ݧjD&:. +e uy =}.`sdJtvbttWje^pKq=w* Hym!$rVu9ZXTJ jåPUIf0 4H%R^;w6yfO %1dRIt~Q+Kbt>aGkz9ZZ}(-\^ 7{ g?ߛ>y-GK|`*4TzB ؀ F;4ڍu#IvI D7? tʁ.gA+#y( S -p9 :M5ddb\86fejjVz `7~.6h} J\UWႬmyq*V%D}WǼ!3!.# ڎ: $R8dVP^גຼ8bƊЖ=*ռZfr^,bmF7iZnG$709Y¾e0)1s/䙳y3 Y0'ۤuǂκTVVySكRnx2c(+dY)䪲Qp( ei]$jpeZ=m(ˋ'1v䩂(8.C2 I>o־?yof/BYRoVyH< !Rjn߱O_}_^6HqFD6"pm}X> Q}5<)U䣭B>k؈Cԃl]!1iqk_ rzϜ8-#wlԔ3XN9LuQ,oO'# t+؃ߕ ANӼۻ;vWd]!\OJ8rӬߟOŵ=vy5ޕ,)hu[eʚ[֤<1tc1烐)| . (ww<Yr=E/L첧 EqN$V8_. kG5'l>{KKK$Qj @sxqy|1rn Q̻ò9q%&߀m4Nr*O im2sLu~mE/|a|'1|GwgjgϺh#=cAܐ.kWFoNVL{SPH1[ژhg̕n;2.T/)]g.H}-` \RmtN&(&%$:?Y6.Cq%EQⳛfpr`nxcqMf{y x_Z ͎u03ȴPMݏS{RJ9nD(M]"! գշ3fMf[ks+PQxsp@ŔJU듘ʡNcDrb̮k`yfՐZ'Oy$Kz rd"\1ų-AIrzʵh1dqNHXi.u. E8@ȳLjLk4|#-Rf?s +?GuWlϊe@&opƹ!%mIʯV%h8r~/Tή >V\vy ństD V[S&w!\wAKa>@;-ܭ_IO; L 49^ }x,R;NIP%Z p3HִLtQkYШ@\]VDL^)@zåJVPڋOF[d.D;Ռ~lc$53::m ˖v IXʪ=Z(,7ӧH ?>͜ޝٿPQ*(wsK W [Ix87˷)p ?pT7q#yQ<o0tӔ͹(|G̠&YY\ϧuf&;DlnbfngL;͝i:uYӇ:j؉c1t/ :>&r>W5R^wDsv4qEV %Q,bagvH5"!٭v#'Oixj< bT&Cro)gHœ>6 Z!z5K˔V4?D2Y`)Zy嫳gKY \ Q7b06q?>7&Ј5$u/Ӣg?j$MfY/ =- &-}']*Ag:+|eݔ$gmIM& f{SمP2-^UB>EC졧LMfCz={%B/2Y=v[PX]Chl0Ii1`7xb[:@X:d_r7<M{2򖐮: W~㋶+iG'"oyD]? A®ȴ$#@rk7 yAWkX]#B_깯Jl!=>X.<=ONTautkfV#jV\/e_~xkE**Z# a}/\.{.3-鼮̻']`OSV QBKe4"kPEè驌F@I+_QAa(JN~ʫh4$ ~4&C*L \+7kd/d%,5~! oc /%" .dMLv=NDo7#$z MQ1S~4I}"`d'I+0Ю@-)Ƿ _YqdÊ@׀>|o0J' 2%O\w:NDDz7O!+?d8*U?C"nU b~R+뜴 `U||kDRꮑ/P?0|)2)jM{"X[teCiq JK nX2PuQ1h)?om6%FU9w:k[3{.C~9ϊ|2֨]K^^fͻ?վs5*ʿ c}N8vh_uؕ7>gYYD~av:*_=ђR<=Z&54KPTT^}-p[+<~aF%MDR(KM!?eLqb;-PK(EPU/B n%m?ZieS?xSP"z?ݡܯBQ B*a4#7= 0|։=\Q1A*7˗eM-d̓f+ڟ6&')3MP8su4^Gvf\0f]P) Yd>Xe%69$m\oA$ɖJSUVEMpDV͙cĎv}:yH)~u,#=^-\e|KC9Vdi ԉnKi9Nϝ髞 Yp4*)a#Vck@~ʆZ6mLGb PU@_g8V\&qWf>PXcxףxDR6Gx3تgwVU&p+ %Gz[&ZGQ"71t%%TD}+Im1M0Нu0㐁@`R*67;L'w44x{u{s+vk ܹruEqQX] 0rm*e[f*R;oW@Ơ*chv+ wSPɋȞsMw5rRm 9 Y9hvJg;EUtUqYjiΚ~Vr|Z}dK|mbFm:^qtyQ(]|#Tm)OtI[aw0Se%m;1,Y]1Ѷ ]|=Dă5mw|ETWt-5:|`LxAdͿ;34 7 hlEL6юD˺<ݔ^V3V$h!V@MRGF8)+ZN>TM| \IO)n}$m.AEC|"Y^&KWٓU~ %>H{gIו—~U՞w"'=c5Ţ <,((:y]m)&7O۶:gTN%S8C>D}% 9=+?&iAN|IJӞzn ji~d/WIiH9#]P6$0r%t9o\IgtWNIJU@]jZ֍?[C:.t4$e|' j8=WMDCW"u8c61 %ZY+1\U( ڗJ $y "j/fT0,!9Km!0P|u>VX*Ɵ-e% o=}Ohn YAB}%e碓0wߔwA5^)ԍ]):$B}.\HzcMC9d[AV4Qs+vH7nOGRҠGox~\>RdfIKr-3OʜJ.~tϬAHD¤0.w#}ֲzi-"zKUX1#AgKRirՇ]Y9)+=0uefF'~:NBykj|. w8VNy݁ګiTQA,. t&Q@{"$}ݝfa=pۊэVJH0JEOB9ǦF8l,[u:&4s/"7v9:x[m{} T yD:BCrVdY^ 9K䥾) 1)Eт$< KR%Spܴ`fޠz`8&"I|N1:u"qD%#96JҹSB*9+6Lvrj[62#MQe UU0=r\W;5cxg( 4:6п2;;@|T+9gI2\f]L)Cf' I -[\EYyHyrgOG$6k,LdT"Tr/6*egK.DѺVJ*$aüJQۄD [`U<;dž;7]WxY'D!̄8aTs#V.`ys=[ gmR.<2lAW_G {R_w@&OUd*L<ĞRSR& rvGf4[2+~T.8F:Rg{}DV Ğn1D2" ȬM+Ǣ)1C${&[03Q|EdC9brq8Ğ^&j`Tp4̣}=uSG x)Q[$wv}GNemt>p\L*Ԗ 5]AgWkuil, 0]!ѪބSEs^-T1, ;" fIMJ,v'pxS鑪Vn>+slwb~&A5Ea`(m $ XN&è. v 'U4Ld$_ FjWᨌpeØUFJr>l۳|^ى7Qg6*IY=abf :q8n˾7$K,=k>q0ewc2fh2vɳx.s!~Fr|x&/ϴh\ >0-Sm('}[ E“4o+gM?Xp(WO4_h~^ƹU)W9fٞbAR]˟ xh3 #Vs$9^4GQ7G'뱛205hI-1PYBBS˵nkZEՈX`_ƁXipkh uZswWWljï{W\5-1mط(B϶ˡ%h%^o)i9\.'JB.y`˼|-킬 XGC?(I LUrɂ,r۫-Sl*kR$9ƀRK"Q ے,fyݳ$s h:s{6U7BC}̣G C/Q@PC,)wSS=N/%֊M@ulK/0Kbyl>Ԁ_Ve$OgP. `K ͅk0m(o9j%_|k VdN+.U19?60|菓cbߎ2c8i"\_{8qD커}頭ةۚ \*^c=SZ,) +am)h3Rޠ#JӨM4Swn [>U`j Wi2t]*y9z2\v*ƢwH!ρ`FojNq\ĄgMYWV{uJElK u WװEБCj6)qFW/١e3"Z>ltgڴc}Qc9PiC_Vv shDnR Bax@&hW\ 7Lp;"< 숨gzП_j^913ӳ]V()4=wl/gE Rb%DҸԡFW8aNe#`cEF*u}PN͏B-]*V>-HPGXMbg/@Eֈ#2l4!L5El$#IMC<3,' :fÜ +dL1]sATR WkA!1#ynu=DA p“QUR2o!YyZٻ .gV$)ok )v7Qe/T]ER?J#4h`2&(QNK7l,Kpkϥ] h,ǯL!_Ke#@-j|TR Af^BsHk;6[=:\}@4vy$S9]ZM)'YQTsĈ{h蓶#$VDAvq:#hMxѩvɂM&rF).d4<6_Ѵ$;v ȶa%0@R Ou(&pwg ))Q.Ol{VWӶ{9)]T=_u}*9O\풵:~ϱOT`<~L/3Pm?jQ'%->U EW*C_k,0Z OM| +?ŻUwaBa8+.$\{~۪6CgXm[> GsJA)G3G&N+ RI%jظIg^~7n7Kk>$z%׃tć \ؿnt @ҁ6WJ+.TQ;{ELMB,-ls;ɰ>6i(׿qV-qiÊcGC !kB>b7iuU+2ChbRƂaȳ1× jpcB|HQ:HG3?4 ⱊ3UUalgwR4d5QjS^%ّ0* 8O-}m"voB?tם-oʱңrs/w`ioY+.,N6 ^(J1=h`02d_3k\8MMҞr ^S4S u$_NtU&%3_!}[L8ѣqWv,v2Usi}_D~*LTo _Rp .ob4E͓`p^{`knh>CVz1NZ:`ՔqFL'XT/<ƪ o"`UK}W< big) Ma{a_l\87VYcX Knl%Z"(S'S# x%r/$ʀ#`d w&WCɬQmE H\pmse-iS:IHǷ!+{j~gN bI|3QVS׮0 0OIo)g vܘY>nͪiwMDI+)lu5$:YRnְ)jXu[m~x ŎG*ZUQh*FH dC:- M=)Q43·1[ !R`"TVW;_]/2SZ𔖣^nԃ|VXR.ڮB%g’#)N`a̺w#q C&>蓈 E68AOQ/'_RLUy 䃢94FT 5 S6nYbSLiIb@ tuFf"dT UN#L  CQ{xyo,uHZ.)vw E[MGj n[1'.Q2xd Ywdhٯ ?m5{@yֆT2O%rkxE̬*h+iz#>ejgIj%aFINHRb"gʔLoEB˓~GŚU;|Zhw}E_:fG-!1 fl T4}_ 3i4$V(] ip! v$6%Ĝ(md8pc%S7n>Wo]((y[n@$@=h1fqnM>!aiȥS< k-(a~L3b%k brBkCDz]ERO/uqzҨ^Z%irh! WH h04ls'MP:E4Q6\*dRgٕW!Z v7 x'>Rm]4!l5fjA(/ H1puGZqAZj|P;\bՎg)΢ڿX–j^ڿb͂g3Ic*O^=Xշ{}wg[5B#Uwm1t&PyΑ 1'^Rqm43F9$v-wj@!IMBK8'`#D;#믛5ԟ}W4l NjYmRSցaD#L÷@zY[ӵL KbW:Rg2]K!V8(̠Qp`㽎ij+!=ERA bDH}mқf&lW vi -OvGMzSޔ"G|Zd% =tl}5]Z%/^ ͆\&p[L&|]4i~ |J>uTm\zw@%)E"ʻR6潝r!]E oAa*i1]5s]Ob Ǎ5l׎m ާP;z]#U芑LA%/f lWb9pGLC<-V] w(C.3*wȖ؎Agf[ )}QбΗĎ@Fbs'4߬sFG( O?" ~ @ɐrtq9+ؓI( 3't }v`TLCQ O i·ɕS3ǜs=ډK {#^^#*hll&UNtѱK? ڡv29&Sw9:&Ҥ ~w*Zb^1 %YƉ|ަc2c.qæ2w~"Ve"&UڿS{sʏYH|﫦:4u{c 36 \alA A;8?ʓOvzݗ@a73LQ>Gz$W}971zH$@s9fSm/3QNj}tVQh4̑HV7A@m`eS}ۂIӽj7Oe^}Db*Hzh ~vb&ΩCͰC2KbN%!UzM D1A0ވٺvr ;jNXFV,zJikJjq(t^QᘫF;R#jN8͆)-z"co]A\~d(g { ro/%e)tL.nxO^qp34]4~,w~1tpbvbY TE}~E䬦 k & aG-^r{Q}5cX;%g-%N&vv EMП(>g9oJ 27FALV9 &?nP8BP&֠56j5viN_!'w(0/QҥG,}ދ悑du4G;vHʐ 4)?A r))4H ʳrk(SG2Co',L1w=掷"CӘ=`p;7Ѫ[_)MaK@3gM?~ɚŔtdnPgyD؞.ywN6"eG Ħ|R>)&G”Ko.z͍`)QV[lO.)#F!!-PXFZH3JBt`$(NլE'*]u M}ғsH;XMAd/zPر&aЎ4~ b t :aWF{/Z|LC 2O#p˨Q]Q,~ jD'٫9+䈂Z6Q1',N2*YYU({Yr*7SO3K^:_K\aO՚a=%cqZ;c { Ay0/JUG%)vyda%_TI/RkIP*ӖDAMGE~I٨6ìٯVWۃJZ|L:A %[k$P3Md^], ڙ]祳x^I*d?o&8$^+4VXcR+#'N4G,Q{C?9d[/&x7LD!t:E㮍UU2]si%I af2;G]&w2gtg;,P= z6 y!2֯cZ^!f<^ŎXR"=xpL;k9۫St+ly)p dSp7KlžV~j nU/`k\Ҽ`]:Y@D*ѕjg[ )%@2lF9NyܛV%:* vÁ6tw#F~B 4xŻ.~xTOXQ[Gd.q+zf պ%,3p)G \RXk"-fP7EraB'/gcI4˛Lp渕niw(\, EٿI䫡. /7g?tZK~_XӶt P+6 E=_LgșbS{5\c*]pB(0\#<]$Yzz-,jc@v͑`O65v&ڐ,n-. UhkmL}*l@]DOj E)8z8l̨uUwDQzdrMaY;z; 8Ԅl3t?$T/%zB36 Yj ^5iYp([d<2li=>fWE( =h秞mRn_o{DfklX>CAPTPePhz$@GVv(0jݣP坅1Էդ\;a\X0u3@$_9Gٮi]wBi \c3K^300TW,F[X2'+9ro+|tʨ1qےPq G t~ ̳x%Dл ]?a-gOZ+}\Ys?,j'^H ~(:z:耍:陓fM?v6~*o ,oή.|%lE:鮵4OwJFL1`v0ljZ|vL&%#>߭@_G6l2޺ԟi[%;cJrmާ !tqHM]_7U%Qޠd٦ąBEϬּ򆢙yCf"ofX3oS3o}}s櫌PbX7Eja B +3'f܂)H4=3F碉F1/~uy\MMGQe0TGh?=]c i'g ɺK~2`<_§@b{:.xkF䔑 N֡lџsI酠=@vlYChњ(.G #=g)(,YxM[[ TlgްvkE| [x|iMZ2jmաZgJhD==q%5N,O9tM"Ɗc(D(1]Ns@&TM]FG.a*u.sh [pC#:7%k爯JM (TP ==wM|O!d_f).Aaʃ_e'At n9G𯭋y65{)Z|0SRMO#`!TkgʪZ b-Ӕl6P1B(ES]:1CDAU5$b!9Ɓ%ܖTbtfҭ>S~LA=Ou FD,Ҟ t]%^|p]T٧~Uap3j^dX5oxtQ3v΄"UΆDxʺ NHkXMI0ZS1cA/RƔԮ稰g,ĨYD6xI6ffQ#ЊXXmr"AXC syGPͱ/YdVtQc?Waz#Hӏ˥Vâљ?|kы> QKϜ+U)^ONx*< gpfw5Kvx据 t lNq&M귎lZ!M-/#)fiw U~3q.͘lйln䏰U%ÀG;kݲ[K#6.瀥}軖vHan[**68|FYrM'/E ֥duDdgRV(>bmE_?VDo: $3nIbӉ »E}K)X1ʡq1HB O~m|*e> LtU_ F? cjjS1U)M&1iw|LDy)»fiTf >NzPʭABG`t\0wiENxK9"YQxm\DLbR+`L70N 3o)3_;uQzXiNM, <\-p>=2cUznaԌ2Ah.4֕9H6*pB//r{La٬/(O:/*3⒮eEg/Qu&:5GPE|A"2XlLp^/*i1%26D`d H֋!95(I ) g\tqH5 !Pjyq |<,<Ų16ܬx8j}Hһz܆ (Htfv />n~/tKW:t 71݁%μ8p\l?_: 뱅>;\/Pe^U1EPRy+8cNh_bdbe:LF{{Mf_t7G^~-{5ZQ|r䊢' /ѵBiǖ/?sr| sI[; Lmyqɧ\r1F(LOji&+(ՋE>f(kd6d¥Qޑvzi;Ѝ$;-;ti#l3 b9UD3.w˰ҩ{:tEuH"mZ *,]ј8Z4QmG}f*=1'?2 [a!QG؂~;y:cxlv?oخgT 9OBO5u|=6]BœMKP]JGq*K>d}lP]Pt:-=3%r{|<͕lS-M aq&,S8W1Y%<΄OgJLr7&\=KDȹOpv)<\Qt]a3bK7bZsKZ̦}슧]BZf9{H>lXS)hS8dAG'>| $埭@ W2C-(cXmh)H*BDI(ef3T;eq\xMd gدϫF -I=*gmR⟊ZA(GK7)*KGSO%kXL؋6Sw^7t-XpO2!;@vxi;ik.L&:#FfX07uZON"\)}iy*1y6x{+\\ tkLZ:'Qwxo$S\͚<=4>,癴' _-Jh~R!;r8T`l8“b<8Smf)^]ڋ7•6k\أu7vfWP&#s^-96p? HO4 aA*)Uf@T)(2"BkYYh$^df%{ւ3}͖z߷hO.' bOuHcϧt( ۞ۖzq ܲq}M>wX>iTLv*MR[ث-KD:0=l۞uqTo{kOPC0c+cSZ^4Vr@ΑE6 |yD] &hеKZџzImM.ᦢlvD7"#_*#}8Slȫ)pA_:&vEj'i#ѶPbPz>sb5vdaѩiN(yuDe:˶0q oP4}>{š?7}D q2]H-[ /}sÒ7sLkE@dN %`bIoD#&m76e3S(f Tϸcj' _:()jB.\k^#ObN,>< |@j;^VDTi`յ@j1Vfuta֩"b9jǛ%-{Ӕ_Vyq"MQs)STbɕo=2wW6ã$"'5vÒc,)[.f௫AG_TpLC02F$/  粌3eX"1L2$]s/b{;a Rh`b?S\䐫Z9xvtv.+1+h=zb?3 u{vD,H^f\jNr2J+l+&o}Ѥ:E Qd +C?a1n(]uYgXz*l$ÄG3uj6:5L-H:(?B9ΓRyڿ(w%I *?!)5MD+U`ifnWE3UZINNv{,W4T#]M} !QBfPlfu+eJJ]9W b١2GʩSFm`+}DkѲ4Rz<{=~T^b1k'?.L_\ro%ߑV>9 5u5|q(Ac,n_&TY"1㑠!hdl&ΐ%#%s5$\2O4%/|kM%u)K2ÛiWT}2^Ä$ l*e MEFnl~&[Ul>6Hy>R3'8mǁPi+znB f/EM-9Yvkm }'K| K)+CqdRZ8|e͈a40հ>"8N:d>J4jġ4w&m[ ,CT lIViص*# ɸ+G=%X$UݴIY'|gY*urHT9n _ܳPr Y/]Ex-J=& +%,e=i]B ~.`HT-D.Bzq\փFޮ@4QH-YDg= 7 \$Dl5ɸ/rs(3ʰpt=xJgT,T6)YwR &(M 4X}RۜR mrFދ\jO>i 1#bV*MWYb…8J{:3J6 |̭m/>t^D@U,y0I6z==*G"f0E:|*5KJ 2w&HG$cB3d2GbcXJ is|l.eu.\V""RrqnA㷷Ex0y[,茂.nc $lYKm !c'UGy- , BH$%DNQ~6w>}?!Y5OH(@Y /љ|<ʬɃ|e!kȹt?fGPc٧:U fO| 7U(e NJobHr: 3DZac  uP/ZFHI~yZcZqާ C'tLċYCd.UoawJ"d&bmlypj֡i<ْ)nHA|ȢH5( c (r>|:(UzCv C+R9$_DgzQk᭸aG6.vfI\Hmثm@ٚnGXv,Ij4%m 8\Ξ6[Ϋ KqTKs9WIV"Jm%RNRUUԒ/gt _U{Smj<;T Kj8پo}SXƯ6JfXadSb̩-=ߵVbg%<7OD @]% _ʹƥ ">c%53oŠLQ h ߻eEck叐 7Ea޼#nz̺ϼYS}V=ywܺ `cr~Ҙ] H4CI7*l1v*Μѳ_WXq.U2BΜWЁ'hjD$f2IbI e8PL4Me(-0I6\7Vn nx5D U_E)azb]vc-S\AiZ;wtKN jDe;t ӫM/p{b8@l}Ox ]@*AѲEa.YrQצ`:*k<8QlZy@&3z W4ڲ\Clol@ry܋M h~R@,@px|0OE"AbU( ]Yqxy3ޖwkI!Lp8_üXt6VC<,3L1S09VўO*8n/42x`SP`^VQZ# {KO;lphpLq[ 41 `궁B!yJPJ(^H+FQ18aX0Y ~r ͌>_ThED ]'_ܜ.լ:ڳee!* vԛϧ|ֿq/iP-U}\A¯+0s0p0+yˑujOzw<>+a2U=lrJS=f!tBabPfC "À<"ȧ10# +(P0x4/geE:P= 715ybAue$F сK7yᅢ˻z̜_mV/p0mV:hrH q Pr_rs7dLfL\T|xWcoΝ7^@Xz (GW?B[̟3_A)PF:\8=/.90+H Y7}ӌAyd-gn/BOjD^!<,е=93c|FxOPaz肄;}.#꽠^Et|NM 45/i Bn pzFPY W>Klrig9ԑ=X=F=ȟc~:YS<)|T.9E0g;Y$/t˓gv4+2`(ESY]YiW26! [[EHI,;fLmZXڅ6/g'r6 |J=8j-Sr kS<>;á߹'UV[nN0\m.]KBa)~ܷtELI^Gl"$^kZWtqSg0T+m&#ɔ딣~, ܂{E\O ڱ[Ő Y܂12)WWˏEqxAGP&nɾz%Y>cgʜn'}mtC.LŤ[4CX37??f{kźm z>-}r:yϝ a?u 0tbh?|Ƅs.@ִ^MivwK7{& '^ 0]c'hL"[itQD׻DHơdYvNxzS$= ȷs:,Ncz(wHIqkHJHq5ŬQh0bC2%Vᄤ} 5Eq&d 1گNhvV^ ϡĨz叾 ;j glPB)xJ/?5D\ ԬCۑlHuE"^˰j@ P]n"HĞ6$yBiSu+|%6ۋ#EA1/P҅.kdLl=Rp:-/ IסOx&*$[v "v)a :{l/ł)݂[p ?UK"o)ץ-zG*{[ijeҡmiX&k,eY-LbLTPN/f/d(|o BF($hmB>6>QFУwn1gxiyhS< 5S#y#\p2yL159N++٥k+i $ #(+s FKg8HtGYۉϒ JN(:9@W$zTsӘfvRlW ԡ"'Zrcq.AR` 0{1_ %J*ۯYU)Bd0bkėɜOMÈs@ }II{̊M[䷁p>ZeFy2O?ytj$u)ӝǸ$/਽:wGDM`mO'@3 ݎ#q|1d8e_rz2TWUpzȴp@8R9äe|x%mOۥ-E71QzT(.w 84~1mŸ\yE{b{N频U-uJkWKym~}DXV)3Wp`FU:nj"+ƾGv`eEέDr ;[aqBy_3-kBZl #sf2gU9pN 'mfS.Im*4ďi1N-TovGGn%CHIhK#TxCW_; -:e+pPcgjjekRh΄c}1_.2eUڮ#pTQ)T:3|+JF(d~VP|uÓ{T$Hø:1AkH2⎭6Q,p^iLj*nw:8mqB"/K 8Rq T6 ! B업jn+dĿ|%{K.aG|1bXxmBC6|6Hl-L)aA|f֑Kñ360^BњQҒ_Pd*( y- (DW(dg$N}8:z\.\԰T5=&@!2ߐ>'kG~_d )(-i ֤jR4v8nփv,hGV ;)w528t9F52O^ñb6 J.r̨c(+[1VsB {S]A' ^(/ VΝ3QoX+.Lיh 3QXLt GlMl Ѳ-P^yDrk^c1$AgT_{\A=@P)kP~Ɋs_lK|'^+*+Q#S_(ws;%ǘv 4(RQpm!WcrQ\;xӐzwLZ7̠P P$tW\C '/q' jK'i \")x-h8 (IcQRR khqqw$@@g|mF7#r7% : ϕFEo<Q&-mc-h+AZ=v3R{RUw-dܰDwS,)oByCzr4NJL=`IDI2~ME3ЁyU=~3"(7 At8q dCYqm\d&ɛ~W[ ܡYV-6a ;>kgo9bַV"8(j[Cf|ҞETO@qkQ4֙$Uedg%uF?IE~CwZ|7ocSnM5>@9umHHK}aU|ZvA(|մ1$:茔a!83b%ou쨲 O4]PjyNJX&%rt$?e|JPoBF:_7iWXnFu|C%U(BpZVS@Iy g5_L>>ۈƾC 4AMk im%i%?NFV\ !O{%R'lG ; ,tCnx7$72qUB_uׂ@#tqQuT-:E/^dϴ; rKq7( :wRpR%rLKV{%!e.Q<xFCzF)S=I.o%"\RG.l[hh1! N%?FC5UvgwZ-&TwZxr1dl hܯY8$*#4֏ٔDn}N\iz)`ŒFTVO`sƏ$5fh2z#rV=T%[cSoù)h+Ս"xIK/M1']r-[Ủ0)p'~e/*-e%Dp[ |}Mq +t2ОW6ia:h0-sSCعOFi&DVUG8bHC~@li.KJ)S"A`>Nt: Ԑ`)YsXjܚl%[nk 5=pAol];fg1GٹPACwSh}2, T٭aZ L81o0S^XlYG)p?,g]%7?ؿ;h @[t> `{m[#-!u船Q;sz|d(:v|S,J~_L)؎owUNq)7^?}5iHc8og)t]YWAؤ״5@ؠYU; ͑MIW&#E㪋F~$];2Kg{ީ禉;j(EcQTpFU"_2=CKM`.؟4e~$Wf {m1T5?>M$%DChzʮȣfyTH4]ɤv s*xZTN2LJ'ؑڢ҇VI{اVB!nRPέmP{ώ6'v=E[͑+{uv<.)4r|4Il_ațX ;ݲOvRXþ vIurYЙ$ڽ7Y >0hQ.X@71AGgIё&bY1Uµ\ӯœvYexve$2ĨNZu\m0 \CsdvgIB@4aVyJoDu}o'jd PmNw ә d KjdZ\W\=FLUoW>)HfRh͕ (tne00hNqI>i#\ QAiGކ%ecXVa l٬Άp|ˆ%=N3X6uHSTilbQa,tƔ!ɟ:eLPX*k-_x߹/dq0K^+(ĸ -;Ga0֪2&ЁJ1_|k=;Pu i .U5UJ(Q|“GQJrh"WYbhj) ڬ[®yӄʅ2IuՍҥT4B)o%fOp'YEXNKQ;;Ma@l:ݢTekxRÍ|\)̖vɬǼ?n'AK>v$ Q^=O&$-i ӦD{:/U;hR;y2vU YѦ7Mxu uY˹K/64D6@mg6>MxX 4.8]bxg8 {X M}8y 'ʆ%vM&jpnn!RWRF:~s3 ^ÛoB=ČCä Hn6hgK;SB $qa?0 :׼Cro jim:6 oD3_)#Z:x]"z hڲrY fא.i>k`1۬'Ъ=VHMBUQd) ϱ][my 5Uӷ5]f9VIcMֻX1&?Ul/cpÈMVC8w"UdHGҭU(Vsx'we S3X_ynmF+S]T߉hQUkL$]&$|1ZAXY-7gjXmY7*~cĚ~ P}nl=AH^zP3X20d*6X%J2΄r;_ 7e8TvNڄoJp)C0^uᦫlpv5.3@SLWFɕdn^VZ .ŀU?VcL &XUlAooj}y<Epܭ1T0OuJ/#mO3V;J&Ld0uYRrH%K2V˰2ZMĔ>a:Wr*~y0Zg{$ɒ^}o!2^fMl qObu8䛤^erE<_W"劋m'yYZScۘGl͖7 -dl lu4q~ ̛qk~(bBm#|,c[%DIN[-=ﲳdYjI 3x'/7k~,$kνK8GG5tn~'vd=<ٷsrH|Hg\!矸u";}#?␫_bwWʥiZ`>}ѻ/yyXaVCXa 1x6'e?ݗ~tJd,/o)jIlŒ%)ǭAI{=60&0|IRxWE<6+f>o<D QJ$Rl0?IAؖo)|{./̎ NO~\ymL5voڿv"~MϛJgjB8I5kXhB(GCE QJi:NM @2{Zy_r3't8hr;Ҵu}DJb2:e@uW;aL;9Le0Z_)ܚmCp ( 7.Xn,jO㤋 5{Bbf΅/jq8y?'yd>g4 _*n<&al b:v3t"= > YH49)b1񔓄Pj&\%UB]PsP׮^ E:,o.PKSǛ]5 8J*`IL80 ,b4oj@HK,s(pH>Nv1^cT[ZCkj^o(PǟRB"|&\(:ir=TebAZ/WyՐaiΕS5ޡNqh=1Rw7v F2.ߊ`:'wf"ae>Ws Ls?izܬ|yoe7r<⥡U,.IԐ7 b3Cď= W8)bU A74Y5Ta ^"Oy\`)lvvx j,~Ž{zlnDs_c9(OTnq\7xykb J^9(V70mQP[CZC{k2jR&HW"~aFvHP@sCr\AO!W^[=2o.l״ V#3{`P);=BDh`y}]!$|?UWqQjEXmhW$KE|FNTvsq\#g 7k(7zTxB@%CtyOBItSɫwLS}J[Ls,$T'ȉOS/ۮBV5G@^^Cl|8j4-%:" n݆?pߜڧxDtO!}dK|A6M;Bf"OGZȉeBn]@&0G>o8]) awyh5b%ɯ8'a=?7=bc1F.YJnex+KTn6ɺeWiٯ@,UG"q ȇ-W>"1)Fз0;{޺)P |n(= K*97ݕI=fkO|Mŵ~:|v)OCu#6qFC~18ɼKU[ffX}[A^ltPb'쪑G İ/̜wM% ;-޼i,puj}h{y_zLv?QGoKRin8:.[?z|aO[q_T¼0ѐyr~@C^(7zQ\ЏfR%; !B-9Đ)4סc$.ͱVhݞ]l놭@[=&/ڢ$Mv+i}^={Aƥ뀙]?BM:0iUS/G>0fio{jDZK0kifֆrmnmm.fϿUeHUHY\kv+ez߼&,Y C[\a묘{-ʛ?Hz|SvؽB' :TXãfzYH1{HtzM|[LD$ e> OZnNu|Fֽ\~6InĈf=MWx( jH\=C[ϲؽHa31}#_ܰrl4& ا0'q!;Gy`_L+4 Z! > A{jPPIqL|I <5F+~ @2 M<%krLFmO2Ud4Tl 2yVl_Zo,աT8i5ح)̤5{&zr Oc8FNҘ3# ^95vwNa 'jODQq^G[Ŷ]m Pؤk1ܪJq76(N$…%,F;a)ZG(%# f]*h0o |tn,8"6}Jckf ةvCU`MeGU~hC˸*f'ڸqЬyX2OfDT`6`IW{Z x >O&QEq0.jE(J]ǎBa2 X1:!w\>tf'P0xm`:4$CArΤJiOzC< l$oikLpP4&J2 5"r`6pڴ@DvT૒a {#cEi,#J {H?:P]{#x$QGYWIQv4P\.y5X8^9>K.sŒf.({cA'#,MIH[RdHs!ô2uvk C `"3+0ץ@E!@W,-6S+MceBwʵJQx~0j e7;% wk_0G[ Krb*|"P fƋIA$|bͪy &6#i3憖˜"'Rk|{ry-RfL> urƭ  j Ƣ^jhi'xMa֞" `Z}y[ˬ7V^;͜it؃ { ~h>AC됿łHuh@.ކcXIU)m+öb}9 n>RTnOF>A<-x8zTݭ08Wk~ 1|/Bt{ǁz0_.+$IBؗ*`zt3QZsa Wdƙ .kʊ c#!OZ&P؁/F{ZL'Cry^SqePpyfx&ĴpjOFb,+4>}gJ(" $̷tKdmISEkYmNhN9пt5u_dQ~y7wmh:AQPWS1H=vqS3*4{C&6VU]C bQ$pKxʰpc͑~ڽ>an9,ŵXd?H op[OqIFqx64 )'bX5Rx! *C.f̻mO){O9ݍ3tWy0>`m9F9֌66qOuaiJ8C);RRo\)2ԥARg ]nN#G@D;jF62qLO="Wi=:ЅEW3En:lAfq5bQ+ֶ܅ũ4-QD{Ym3e=fn&f'^+e[O}v_gTՀ87jMgӒJk2Kz3< o$\pF^zN'dJ5\OsFŦ,_þ)XqWӕ:tW3CqvĞJULuXS]NZJzZ~.O8n[d#_c/Bf gx aNԵc.ƈ tZU*&ʩ*w!x1u3ZgۻwtY "K0 Yr/̛UCe7 &S,0w3EcΑ߃n*d#jt-5o/[s8CǺ vKo~ru[X55 ?|C Tkw"BpmR~oM ~g SCvFAxSdpN>Z c /dN̑ݲaTd#LxA LB6bv ӡ]XIgzPk %H6kM $ff~Lmk}›#dtGæSn@DTi38zأ4TPVâv+0' 8-** a5tM(x!nWkl@%wx5N6"u+J‰fi G7ڭ[Qۄ2hwm|E~$ù:PN{' V2L0UGJ4{f̔,vSsH' _*̿҉FfE 4.AVyI*j[a:JS u$*sU&μ-Շ~e'& R0 ƿ8usȁs =1[A,?z`>l{d?7^Iv%nsṅ>svΠ'0#ÙW0g%X7}i}g6R;6n; M =1/Ԅ{;'M6WQ7,g5&ةj[m&aҪB IXŢ;j_ϒҞ RUl9"AH]Wbʝ1(,2F>L &g}jx v&5~@{ Qks8x-55Uz,Fpb:Vj7oZ5=q yETOB-lE%}2] b\N{qr*IIF)F 5zF:mmd|,3V{,"1e_&@:86.֝DZ8`iq|8"v5h iKԁa٘4pi=q@K< sg]|U^6?M=IVJKohB]OɼEBɨ[L9as ]Po&s*F)Jt:\`TpjU솠P6/:5z$b݃**n& _0"ȸ ȵm5V&ۊ`yَV{UiYvr)j:[8F}C%ܩIUE;ϧ"Ooh vi W-֝T(Fm7w8qS(;cMeyAu=[ _h۽N e9ÌqpZ<7xC ُt`w3Ic#?!O1{GmF[1% rluL<1ձNiM:i6j)3Z/pǸI ۭFlM4gu"vȢ8(28TszRfZ&dqiP )*-*ލ-oݏOXMO|n b+rռ߰2ɳzVз~ߒDxd /a:DX-vײLؒ d-~AưZ}[[c._7 ju A+Vj=xBa{S63^,Ac4ޞ\5i?=SU57Z9v0(8"bi,Tޓcqy~t*Ju5V94%?/%_v[Z܁C'r!م.ŮbH-+teyxlo*gѭ>\$µR?Fś4 GJ! +Y,B$ qA_0k˅lWJbDM א|ҵ?wMLt)!ڻ²!Usɷk~,Jz'uK#Tւk} x.`-W[ӵ#]&Oqn8pzWBGc6d4ïS$갲-_װ< WpO/5]sF]gZ<2]aa&=tY-?˴sx]gOzvsϤ3lyy02=l!ZCFٗնR:ͭSBk&u[vҦL6Ν۔DG+h9ꛚ]p"*AzOmr8Mn \O%2e4 J!+H;JtkoLϯ{\6~{qɘvsmP6#ͪRtICײ\~Ljk vx[1 kvyZB'odh$DJXRr>Hei}&'WYS]5 DxG$*Ynq{5`c8A'5MpڦkchLKEÛU Ͽka=^X̘efHy&`cu3:A^3ca4{X?|eK@|ݠ-0 7obhF흄D$$k+CyFZ1KoM4kH<զ8jYj3Vfzj@`vh̞%&t.\v 3L OF!S55N>wHWgo̟a1FN {e͊U q[z VcDq<ٸ᧮Vϳ{=r$7+eH$DIߋ_]3Y:G8q}{;RDd4RI߼A7U|U?+s*ãL\ҁlf9r};N&- 6[Z)ٟ[V^Tg;퍼kiR3g}6!M+ldaO:ddmE4cQ"#lWe='/όB.iOC@9HJXdy͕/Ijd/9Udȷ2h9.r:±{x"2 ԮVcTu͸hc]U? %컉 ѳ ƆIۈCwlLWH/,}$n/tq=mu3JQאIft2OjÃꩇ/5qVВmq3a3eK5óW{nL~J-U0G/uZ'0G{ k`%`d]$+AF-k_HSM0Jd}}J~c}|)>g-}p4>UͰ Pf sԪ%H'UP ÝQa$+`D?M!fYV~(50!IWZVoI㽜mMaXJO*e& SRPzǿ~SMۻ<?B!l[^翂۳?h4,uoם[\.uXgMRF7$ k74 i Ѣ7;0ZA_O jMe$zم)vzBES$:ްs ސq ʅ 0.2@~̎J6kI.7N nʍ~ {sa21+n#,ۭ*BeSzOpAOP@NJ3C[&OYꡎHS)rRgkɜRB#.wDZ)IA'ȫ?A9m4aNܬ_yKw*~gf+aȘWWuz.ar48LGL эڪVlJ B_ԿɈZB3yr϶kSNn(ɩ{H4h (3PLzN9zHϭFE+`ݓ/37#f 潤ݨ'+uMoģgcȕ Y9kiM8(AJgrA_?<<"~D|p@Nj ( D`q*JB֡y廉g^T QIZ)|4~PϤӇe%QYN/d "w."5ִ@8 76HhTgL{BT?WkV;L3z'*x$LO-zYvwhEK@TSl*blJX#rPOR2F#%'~0KKzAX^ E1&hB>hn']Y DT')D+=P,f:%$x))<#M&+% œa7^!|k Agmċq,g7t:h&@$@-zrX IO|%3z'ILmHq8L~Q8-X/k iKZ.@*ΑiI$ f€&I:ABWK=8sK+ w gP([m̍>E2 c$J;e jr*dZ,&$Zfm5fA`nf[޸PJrHi*8P?K۠=<}E_,\u}AkkzJ~<*=~VT@ O4ABh%'(8Y+>mTlݤT rc=:彵 ʉw'[Ԣ/XXӵŋ,Uu5]69v8)nHǘ3oFdRFK*kz7D+U͋`& hߴ/Ūs (k ~0i^[~W5 Yw3٥Oƛ%ߧ/ + adBr3X2 \M ֢cx<}ȊzZ^Mchjbk/V&5g޴"&xgmw|!zMF}z:|oH_&%'8 A ,ɗz20h7c̆ROY Hٴo!5`iz$iݓ7 {E&"/1y ڴ1]ZdH6E-r"MIA&ki'EiQ\QP{WOQyQt]|^W ?B?}uS+/eQ0zd[ j| G$od%Ù;k^h#*7CC}dT u*Px5Ej#A?Ap/RlXX h^=> Fh$kJ~zN7)jϤD\i44mоΎRuu[79yĦ {UgZ"S2Sx +,h"\JZE'k(FEҦ$ɋjŪIתT7)Vs=Q[/Q&zȤ֭n^PgRs5ًT˲%:;^byobT-m3~v5 W-*Zf\6'h M'jzfĶ-MNZ/&+G|rقTA=E XW,C{G_(^ʹ9gߜuNնN䤎('\%-E=pmU6# Y_3ў1CG66C%%d4II."?<Ԁu-zIakvޔo[j__<U =cG{~f ԘC<ʎ}z@(_ҷjFA 4 l=!] ӗRnydˌY?K // #YHUHq{?dTcWeVm8v}\*GY!+6͂%j57fe>gs8ƌƕp+;hK0D2;ׅȄ5󴠭U831y0_n~C\WN|=d2| >"GŐŊ,B'ӡʀJތR f𝄞d_Bd}#X\|T-}; 5 #1q9]Ρzѓ%C!YDϙ6Fs0zPKlk_KvPA+:4C6+`2|֠wv%{3ˋe}s":'Jfcא5a1E0 ]|.AEE %=:<JY>qhBwn]N8qAIGq 1-Qq{Y(3hlDeP|IK<9`Ss4.B ԬcAy^H_|X!6Vx1a5 ;oFuE'=w՜{0q׆).JkOk Jy׍ Mh+= HLj#$OugNY(dU=Wƈ'K`B' Z&* r939qc/7J3AtKkV<a":HQ1N]_sA, i4UH>;\}IH Ps!r`+N4(?_!_]Ʉl464eM:RA [.j Q"Y*PSF7$UJ .yQf5S$CZv{fgus =a.7T13x\ q_kyvSq9R?q-t+gR2Quإ{8Z7Y$2pXg ,>Dw =DgpGh{f<&KVegl#!BJz!+/PB$jֽI`晞~z|}Em)>;"|I(AL5M V*,`f 乙mr?W!Q̪#jb-b]!b\, Ȑ[}Fܭr/M=6EW?C^~qF^)u }(i/} [2EJ\Т~*0A~!%,w@0$3hڱUWd -{2--tׅfhܡQڬ+pBVvp8ޓ32VUhIC/RӁi5Dma|H"ȗu v$FEw-j|ZgE~uy:4/!H+k Lǂ~_ەi 4<(O:1 -1}hxZrIc+3?=[!6,%"- eL߰ؿ*+kNA Mw\ ~?pAP+[+#ȭOc4B2E?z}g{d1~QɡZ,0Q-);Li8ZzaY'l)$t~L0 =_jhkm3%ijrHeyqR譓eb;yj1+,tTkP 3C&kfHHNAt;_ãoj"dtAa8U^WOy{@nY}l363E@q!98FYᜉ=)v뗎t=cLc+E;,y eut-$wE8/N@( 滤ÑQ43gfޏW}yiRkQdޓ[:JHDFwѢZcܐ^ftL̡Ƽ&: cjqT3̘mQ/E*bej@#a:Ba٧D ޹?%%ڞpDLK'HaWc WESx{ͩyOu wQI/%TV_pMR AdJ]2ݥKHv46W>P3ݬ&@e]PT=(Η051.=Hd0:Ѕy8#M=[ )],Uj?R,҈`F$o/@ (??$|_?Q=_/.<^Tq}.P.@AE4/}[bp@f闩 _{ܳɬ8WhӃQԐfL [8-E..%tfIu*; Fޟw6zO̬֜'cOއ1WeV4_:9;5CrI( 3 r #ja.Z}ۣ'q^#qYw 2gq{6@q6ө=D.ĭ,f2ţ+=!?$ uv]] Asiku!y毑"KjhѲHS`4?rdPr桵GLhv bd|?{'̦;!OfIidJ^^7CrNB] 2>ØcJeݪd3"JjD#i̞X7ZtHgٸ;>`Cxu"HdF(`@' h\H rP T7P8qC~)j rӥ ̘ %TPl M&S$ٯ-%2V#dh3zPvDbMeu#G$U6BY=UgĝJ vrR݉ΘHD%QFQzc@(w7bO&'65ʩbݴ44##BKO\̫żnonZ)܍K*t`2}B-ꐝw,,fkTh#[E͉QJhEmˮfi RfmR+9nt;=AXRq9qYd[ouuI"v«iȥerjrւ>'*|~ӚɅKtnDU_fKL1YV 6N6Xӷ| =6ܛV bs !TT'3]$ciuȦr5=w0[uT^a)`ѧ9O֢q{ Ж>.lc%1|SM񍛯fģA7pQc.c8'5ܛOȲ&gSzSC+|S"lP$Թݽ-V) 5)ݒRM ;'QW'w$K-):Zkcwנ#v3بk*ُ>bGtgύG=| 8yV*0g 5oּH#'F˳$}ZTЎ}uez4Ø9}~{K8iއDvKw};;%p}fQo,͂ +z6X=Ɖcɬ46F/[kp;_',r9Y1#XWOH6MRJC҈W`JVzSM8*haW']T{m_j>ZmOQ˵}'/e\I}Bg3YY-:}M PRF_r 2ڰISm!EJ|ĖEDg7oËw١Aq98'\#;{ۙՋr$d@7FTN!x>_gU\N6lifq YC&S0Ⲗ㎕2[yIc)R2Ie'rQ)GI(7Tbie?.@Nɖ &efN5.`T}D]b^=kkh*!NX8蕳]uHes@L3)&VYAey Qu|]~V.RTCDBČ`*ah>M6 Dh 4/ҲֱL2˒k,ٙ2 2aQRLC !%ӂD-pQU)DvcȨE*LFBHKO!ÓCG A , zhg䗨%f68'?*QKeya.7j|'LE`b\,.: n4|B.a/=*;SW E65DEOF&z8:RV] >zd3x8fzS0p,~AO-w5f;$D9 ]qE]9/OLo+*NRD3ƖOsĒ痖1-q/;ޏpՎ~z}&rp^"}5KgK'VBo27e3Vm_3=3Ia+yd' )ltYMnD4rVVFuRNjmw _"QPBQq+==5!037)32tf)R0+inĘNI[S $)͵KvHT) &Ce&)̅B]㡈dIq$fv'u,4 م_i98A&ІtK8Mғ - t34-g$ ) hs?D`Z-Es1""H]_.x&ΔL9NH-s{kdžxo,iͩds;HJ]S!=ПƉ:}O 0َb7v524{ad)xr@MWuEIKt5jzx.Wڥp:%aC. P.+|&KCu٧#;4Uh'-c#1.L nS;E[i&~ JO*cj|}v$CT]ݒ 왕rb?d[U"*P?cA{ cz͒i&YpVE>f 'TY [LvGBLD )}6\b*GlyS%c(fd;<(V:^=ݱ&ձc۔u3wDi߶5I~D]'](EE.ꑆ' 2ܞ4?xg$Et O+zjmi$ cĈ6/꽔jWRaKdL{L Li T\T4HVjL$g#HڣgyB"R-2Tun;crфGMJ BBnpIdnqלj=A5kŻJ}%*ɼ <-?s{2~TcGO7$]@ygvfʍ[~ 9Ĺݷsۈ3b9{ ˣRJBRܔJE]_#.]TD,HTh* iC|%I5O*4EqN"_:τ&{8!p.5| i$qLH)WP2VN [Oj; 8OI $+6 H&4)/P6JQ[E@% !ߤ?$ N qpEEҠ0g$6Y|Z(Ll2%!Tc߿X:1H&kfq qw6hE:шhRPP5eTfp.‡Y$@y̳ I|aN ?6ffd8#P]3Sv4/ݥDLV]g{=ER4 V=del:WaGÄg^>3N7aI uA $Y4~mq{%fht[y7vt46юzШbB5π|"S(MI7,S(̦G(kтN}^`f(NDK#u $ Cp{g}w~ E0r( ro=Yi).MzZ'yjEd]XBJYS ,w9wI]Ԟ;֓rBt#T@`y5mE)gcRH뼚C, "\+{Q;QI9wJ[8f8 )tA"iGaH62GU<4ӿ=R_3`riN59-/gCsqWGtTlwcCu P"@,eɁlzN0A-mLm9uڛ fp 8U]"a3 /h ջye4c=HP8ɪmOO"Yn8OLd)/!=Y8}2ٯ^-q[5& -PO04;vCkP1bq8 #hBcl<"蛭?0 eaBɸ(U jśحHT3TH@z@.yǾ*h\.ߨt+\ F9ߌktӯK7ެq|Q?W-tIL#i(~6oro,!P1"ݼQJOd7 cZ Ngl 2E/*1(hAmʶH8jCmLFO5F=d8hk|؋>;JI:HVv'![ !Y FQ7+ì Cτ&Fl*"+HIaМq jqGNqPJj[>rɐߋ2l͓` [@! Go äuN}CWRyϧAy_ovѸżx%J;FP$ JtaȻIb_$h&O#dv3:nufԃzaIWOh ŞA^$bUjeR(%3#^vC[Fb84>^jG$ܔ⪍RDL=}*'QW+GxșO 3S娓,?>7]o&ƫT⯿Ѭ? Q46n$g'ބ8^K51LE 4.(EAɮ4JB4O di\IZPqrcqO'zGdS(8ӚaEY7Ih\9qLh: (Rjq{%"o5(ng|w$)䦁]F-`W{F#Fe[~QyB_Njȝ-[ўBJgAS L4o]ܪa_hܓHZ 6ϠǤdAH.j/|&䋄"jNԂMϘHCP.f'V.)X%Nԉ纉 #B<,d߈Օs1eKB*9vY"|ĸ u SE.3:hgq@a\Ng. \nBV 6awʦ;B?c}b !zĎ-bSG*XQ#3FG^ 5L6/3\0f5د2r$(ݻ$koEwq"hyG`-'ex!edE@Ϥ$`3Th] .,=?v.B} %*-?)jTQ~o7n7 ?F^B;vQETXxpu сB20 $~) [M!|(ҪY#e'esc'v*8NyC>&&+S}h"6^ۼJ .(Q\(&19iWʍ?^q0沅;:rƏg3gZIo[d<.~8՝Y#A7Ŭ~t ogLPb2/zmNVaZ#7VrNU`{GSnU~Wj]NZc<|v*.<_\ d{YV>6Zm#ZmA}s*C ˉ؀ko40?7ͿN͵uTHSݤ}V[/u=4!BZU1==ѼRPF~2n8)X+7Q@A,Y),:jh$ BBKwT 5`Y+޷,udZ׊%*!_ÆXr)V/#OzqhzT14[ Gm̓w1ŮحBkaLwK7CՎgh)в>m\">jơb\5NA"CTogYЪ&Kjh5ˎ̴je_q=SYoeӼ}W[ ĎwUl9+_{:Jz*lV=B/ىtd>^,o5}߆Csu^fѓ;ZPUfGiѨ`[)ȥ -V͑-0Yӓ\N#x|$ɍ#^QH=:v<HVٌͥ $@ r٤\^zU`:0JnffiP󉀬" ~[iBrοK_ztw>KىR"*wG= Mm`K(`MA[:"/Ra3L!:6i8n+Š,B}3U&;qaH9^Άr^ԏ( >Ed<[`Uo8Z ߭yh]hP: ;?PVC|2( g+h뉺G!y`\n$ounC⮶(TgY&bxS!T n쓁atr_gBB (ֱЃtXl8: #:PIHSy~" y_xI'HZ" !7{ $.#]cA"ӧNeAE6189/t0$ Gc5%q~2hX9gVp{X㛌4.3yl}<߿~8G`\r7Ywv##u ]s\ H_?xw'{{R4LhXV*0T]wVqoKYUP/H:K rf$YڇL%K^cT 9Df>!*$|º&_AcEtI.%NEm@+ᔝ:hPԡ(t}!rAh@z B=6 y$.1R;gJ 6$c(JYAM]0د#B~qafl޿;_]35ƚ{틈JQ"$^D|| 9>.Ї̮ʋ$!D󧇶r.< U—G8In5Sԋp6ݳ$6"wk=ۙ"(m2',ˊ죧F a.U0f+)Zαs[ R|aeM[)9 M1en)kzw]Olf}ސMSWS* 9ȓy1 >y(!Y]eѓ֥ ߥ< W{zU[ s`F~*RH3W$IJ?OYdXu\㠿lyx ܸa7rh~EgdH>M !DrHvćQ_vD Us#~֏Y/:3_|Vb3 y,* a .g RXkv#&N MCUB(_i~>g :{ᔚY3/TZ5%P Kƣau#k,4NqPWgyguHU]-([^K3ͧpQ` }1%>:Ц&آ}`/ L=v_yK=%QwZ UkC-[ޕwNyQy_*c](b.v~4<71^hfH١uJ!MNL%f#ZTҎ`&߈;L8p-! BuD*Z*Pɥd5ȒWG&ߧ%{p` xrc*EXyTI<\#>8piٻ,xeDIXs@˸%Va#|'I"_bNF|xҒ$moK~'v(Y\&ڳ)e4đX7gHi yۓE׸_$djVjfŲEu 'col1QT.9/PJtg,lj[9OcW];R1duXZ^50U^ (; lH399VW[jxۏ[%6>&c%Cyl[S˱?9?`rp_U_cy^m>sD ;t@?ß(f_(^5u_.:Wz^iOYryy݂(:Kn8sK싄+h_B1[#q}}_iQ6=ÕB|!M8fhPU;(b[y^k@PI!4S]iҔ :*nϫm _NdvVGn7`LОI3olT*hDyw7{ab 'CRBz&~/|Qe" 54-w{rc^Q'OVsw= 5N}s Oa GT[RT)G TPjVRTYHI&Ha'mAbn7g)}Uй M2Yfj[9 DCMMc<!{'mnT.>妗Պ'ר8}Z̝.֣?h"Ik3<}Yr_xD$@6}ຯ 3ȏhƴOvXbu2L w @Ol%|ym5Zu%Iru|!JDg6/bYQ6:mYH|*T-"JߴMV̈4U;޷,<'G:e!ܓF>Ad dHsv"4GYJ1~r u9Ԙ8~$NxICAc'hSNt|ap=l4^+]Dzyٔ;F]}YAYozLr)0B4GוֹȊB6 ʎT m{z5e}1begp=.0& NI"e.| wv?Vx}~ #157 | RxBXPI ],u: 0I !éjɼJ+IƗ&6Ҙrq*hoYT}8g]b>-)Dnx((|8CrҗоH#+fT$71i~0qk=`?kRBc X 5P(,Y]ŵ|!E *2ίdr ^^SuM'-;'=A'(yԨ{h.rJE}xə'ν޹Tx~BA]hM59=KF2LsT{(Q][}ҭk]ys5c@N$0EI\XMC372yѯH*@VHЇ/S<[R׈lH"J6l@Hϖ3!+?pcx8Fh2,F9>OjAVZKZ f~Ncp4{#13 Ε'Va$ە,K?_q#NSy=򋙥bBEKsn_II&7)g-|@ Ap}1`ߟ'A!* >蛍m(|Ev5ٗknKͺ&f*lhWkV)'b /qRcЌQ/tLhNOh;^'a+"Z# 7(zE<3e6y̭9&q*P׹jNKT7RQ{#ګ?!K!8l:rjI{Ļ-ꋿEmU;!Vm7QH=cm폚j K9}1F; \S Ykڐ`yz]Y0rGEV]㈛t``c\J;J||՜A% )`O솆/>Ͱh\?x^xX23|sE>'{;|N}bJ·8\|џ `1m'ot5D!u# >6)Sj;rcTXncW}nIńa,ޒVm!xa̤LZ1<ԎMHm ~gt3qz;*W7WoL~L&OX:cLS7maްWÄ3ᙅYiC t0~ jp"! J_ qNV^Q!iR>(Zʂ4mkw:M\Ge;8B c0&yde0ϏN~[KLzت] ַKkZS"!n#ݝ-TVdEP5 vђ=_^逸ݻܻe6x[|V h}Xx>yGb)9p.oY[ #&_LWQGtB/8?ZL'xC}z>jz%]rh\żet@ 2e+N1iGIdb *f: (2Ibާ yºCwEH*V p߰ʹPh8nc-;ą򺱢ش~$Wu{vrHsr!}T'] tO 8x)U ˵Ҽ߳hG~0~|sV͔0K{ϣdhTOB\B7 ޙGyc(i{ăW&Ҩr-&Z~e[B#1K!N-$͵xN 6j:hmdDV*;wg ]6i *#VtaenX*v ~lGSX>:z %s$E@~ҳGIv)[/F%pz>=t4͝MW}oFHǐz<-H&̓c\pҔ6<*}OmO3Zĸɽ.vg9ƚik>OfK cig71hU_- \7Ձ؊նn#ˉ.Ә@˙]l33nqH3OΞbM`嚇 DH.i\PK%?402Z1!"<)/e&JeUgrḬzVvͯFM&gɧ_nؑ)| ^٥NU&7J`EF7MTR٭3fjLl!:oe>0PR$R\Ċv!)y j^WQ}IE2ꂤ8-Ul01HLVM;b} @GdE-LB-vmR0XWF5>Xv49>q*I5)fWFwǹ3z*. /=aP}㩼8m R`rmD] 7LXAIsEUUnep9"zSv `=j2MUQF(+baW<Ʃ ߑHs^hۆ!8SfKWEꄕu㩲9`2foP0޹iJ!(a>AMxR*+}Cxgg|YS5;D oCw*\n^/XHެCrBugi ۳vR^aScjk* :/j:@XN/g>}ӔL/'/Q˥u+3sχ{}Zxl UC}hڷ%T4ES֙u\\̦)t/< !9/RjxO6>RQt(DYά,18T n] k%X ;6[k{M[VH>WDW96 F[cu2$l"M[zL{ni24dpd5 1[)M3W mͱ+|H )ocP.Sm!&:txeX}OQ)VZA11&nlHE"chu>jn\F{yMw(Ds6qDAzsaMe&K ov>\c,ɁM% 8!Q8?RJ?$Ó5=t 36 %/o>˞冕~;OþJ]EmZ}_fBZmROQS_g|C8K^-fҬ!ϥ+GvY_Rt" j)L#w̡F'\yG)BaI=Ag2\KdpÕJ IN@PBJ\iV4"`幾$Q7bɣoIa^Ej`(eBn`Tb#99h^!80f{SAg5jb-[ #jp+c^>֩s/+Y%.iq6Jd[~F藷ckkpR)$sZ*죰QǼQ۽qvdf#tY7{ƁwpX/QoK3~*pk+%j gn>4 q7l8G4pcKVj?Ѳ!j<-9sA;SHysgSlbӛ*q*rE8x ?Hwbnh}O( dagX Am+z49X Ll7y>&idQĪ`*̐Z/Dh],%_ 6u6Gga I6Κt2m,}ʊl.2a?x1JvIفA&v\2MOx[ĉV\$ى!E]Y9x $$}]f u$Uc2S3H VtsyY YLga^9T 6gLN,7RD[2waX簪;Yqٚ1ll P:ĵtHA  :,a]j&nUTB`O "V48L:Ynb  Y|/O?+%VBJV9`b˜v"Cܹ/B8g|ڿ`U/SS =QR+p- ?aB =\nk H4v8<(9N,ҦeYw'V9VfNĮh5 K;,dtH%?.9B r]t> SjE_3m[fDs"D&ڊkal8_!D(QfPCv5 z;SD [fOtrS&n)18 "1 |\BI*L~;G[͖ Aj TR݋dR-ˤw6D|o&n5@0/k݀DAK(BB|R9qVϙqƾZjiVeXF8doX5#$SmTXt튜iBXZKegOMK]\0lDsQ0׳odXlIc0YrV䩈[#D=G;^Ѥqej*TD<&f墵&:'jwf-o򪧝‹T*xpEʶ9y]t%s^ui$CU fxٳlin Ƽ{5tR/vDYo`df,Ӽi.(0uBx*hTk?co"^ܲNwZ (yh UnŤZ}'ITϫF;"ҟm5\Q im֕?\Yzo^&Oƍvf^m~Y?xB^:B9S=2ɿGg*}uqID3c0OzˈЛ鳓%e&%ETRUSP[%{!BB M3O*/JwX|A-Kv|0\x`z`]PMu[ lZ|*W>L#{|z`P+5q  %:Ć]#~@G u\lꓐ8ZNݳ_wxR޾)e߀|AysCSX:;֫A[4 ިZXkH~O$ fϧب87klȇ*kNQRxIBԀ),(IYH[ iڷsS9RNJ&,lNPa6屷[J,PⰌ6 %V[m7{dk)7RIjZrկS4GJϗ2+\ `8ą ,/7k*qՐI!.X$3Rp'7 3UxlM# 1XB._e(X"8e;:sd6I?EH7PMNa ? Ʉrd (Nm-lĒH _7[>nAU_pvə.ݰNij%/g o~5Ts[^8RmI鶱ǔDZH6+LqXl39-\)~gGҗ سPH$ɠ])yc. i6Hd)*To2 m;KTSlB8TsGkѢGI'.y8Qp"i֢.RxrJF, [c{KaLR}a,e\S|[jRp~T_KMkMwZ/!n2ۻ_zc쫪:O/],GmdH.y08&hF]>w{ABXaG(RMwO[|Lct[;W8:Xii1i'7 fߟ@ "^=欳ԓEM"Bo͎(le*Gu]*[1-RWkq(E:no|fnCUkZSAr#&EsD?tRx C/-yp|rRFRI }mDFJɴ Z!Eh1ɺd䷤!d=`RyH.PӖD's  …b- 䢓 Hcik-V%K q姥 )4LhMhxp[?g4xO]̛)Q%kC04ΟB`=W8R>@9Is%˒TkzzjROLI&A`lY:4h+Af=O{A\_H3I;>+[T(81,h% $PwvBHR-?XoHϤ}U)\d@gDUF#8+eW,#5dƺ,܄PkDzexFRH~ k;;/OŰ52;nxj6}/ϻk$s(wH S1* l2ru$q7'>U&JyTN [֟PTj $5:C3%%Đ.Aĵ+ؕU)&RCmkhZׂܤR0tM7FT)n3u 4Fػ3/Yg^]|Y4C~ :KJ/7Bx g`{Ghl$:Ih G`EИF"/-dd:j&Uj۠SK x]\ECGX"|ַ4~U9I3xạLE>{-N=UXV5e(g42LeH)bz5FSCtJ≖Ubԭ/Hž\E[{n1JJ?{$fVK7V ?'yBhz%m#aMTt rCE{IչEАnAIW zPF[VcJqIHfBPkn|q\mu+F¬:Iq|+)!!'9]{y-**zTԸnk&UxV~ƨgͣ֐'Mc.JuOأEx 1TAv= 9XRo!),=0`O|KMy]jI)E)֒/iɈy[PAr#C> 4Ɖp( \  *Qq4} PXbզn:Jř;DT˟_^ NO ڃ966[c*s((7ʮLQ%di̕T .̻_p~Mo ۠+  N/xfuY˴o_xl8ZPSdA jn5xyvsu>ְW$"HڕƟ.\)dzH'ͤ>ђFQ\ cw / +}~Ccj Z4H\פvKBiPqM:ͧؼ]wŜ%IPG0K7ـ^htO  f:i996FYBhcΟ+氓@uoIryw4p8q9E7rKds2; % KqQ;0\!X9e+ vNz\,va8%vHy-)-RYB(䌐$Ij9T:>$KlGrkwAˍBԦ6Ff_ơ$ܞGWepY9y'}UAn|zYAkxx|LhwLZ$ZoL;kj@~"6EaǪ8:34W{IN]kB9<ʅP\kg%4 xg8B)d^Buv2qdZN6aGS7Y<{MddH`⯖% kM QQTAz_.udd8In$w_dpm␃gtuS9'Ʒ mGrnnrdy8s( {1w SԻІ!>dۊW >&2d~ m$p8%6I_ag#lfI2дjߜ5Tm_yTSewzHn{:T}JԠpxiAi8o0(nMA+pʷtCUT›UT٩so%h /H [I1v>-zDū5V9ſcHQ֢1B~k]X3]|s%,z;yAIw( ezrFqP`OM I'% r JSՎ S, N}+:0}2!+J M#w%gFg,/0 S x礳-\ptSkiNW b "+j z!jkʜn`m$WaVSb54ZC-%7MԚܚ5^$}5K_Hyp&荖]AސyL0xnA' jYtu)%irkճU x€hwkˈf?nXNR sܪl/}\؊h;BoXSf">S%.NeYz֒yQ.:ɭ~.rq*6V˪SYLpӯZeanNv|KU(B?9qjH4aOW RZ3YͿAш& w:?Es 3+T{"U[MwW 8b(l`V)R8Xv߶+J 㗠[Ԓc1y* ԍy_t>!;LBPYR_FBbՍh_W2\EaAVdž洯|Zy'cyXe5H~}MPmT۰MǹDΔiQ߅B2y":/2>`j<ĩ cY(VHA|?Y's;l;@K,0y/dMl^I|?00h-ʓʑa[)RKtV7A@0̧V-{|!j gty|&Z> Z+ȼۼٓq졔Ka<[n^ n_[D+6NSW0^Q ~~Vuxœo~`&c?3ڂ @? K ʙrt^HGڔCn_20iR:j$rӡx$` `/ZD97R7, -CKGix)-ApUچZ |85aac6=&1C0BZhHFrܥCAR+M$ 7Iv'qQu2 jS>3P̳QF7A>$p9p߃zH5' 5uq lgN8 Wlo@Ss6uvNO."~1ٽ͊@Du' jϭwlC.+~OW8:iя\`XFUɉ7WUZ`* 8M H9azp8AXCR{3ҠWc#fs9 1gn0 0QC MJ5; ÿD*gěLISA 8$dgXi(lϯE]YTFB`*H}Ȯ'}kT(&w9x^r`j-ZO*E+[ޡNԾ23 nbb8s1eIaoq ӔOJPtqFdDo))N 跐:%jR=Y|(gPAM?<]~aZV ֎4ĉXB=<>9g}Rk̒.Oyլ%0aW3o"^鎕NPU&:UdCDn)7bqW*L p$pzu*̠] !,O@= G֪<{ms'ǡn*忿[řFbm=!fNs(bq3qS Pg#{+/ci{o"ɑz uVCX&NeƢrlԶB,Ǎ(=.u~bQ=$6v$˱N #EX[#3ի|,$=FrL"Ȃ\WJ*"vǍzY0g8 a>ꉏ"FN%|ce8Lɠ^UV.@9`,Xc۬n=z]+l)6ڔv!),\SI J ۖ$vP^ܘKqeN_,u3fPJԗYACh8oOw9Wx_Q(25Uo'*ps mWKTkP#ի~+y! P-UZ/;/ߏGʗJ2IdyJԧ`#}1ŝB2 ijl53s<1^Nc~!6nv(FOQWz2+ (=85 6H)P@k^s38/V~wAZiy ˇ=cX}󌒍b^.i@5 ]#PRY„yY1 @KdǟW7g <`pqD:`V ֠\Ý8UqJ z{I0e{Q`ղf_t탸XWWRM֖Bt4:̿s~gHџOݰ,F;G-qc+ :7 &ܴgyczA'm+u>/?d=Z:;J^eoպ|aGk3H'oEgϣ"&Fzɰ9˔,8OާHn:jf,LHoBGG3 ӣ q=u0yL2 !d#Pslnp1țJ)#Ɠ\wJ pmX!žB(wlByjKz':<U}o/㾸yc|52=wE93٭#Am^L/8[8XcN [2n`ӧ_RiVr {+Fcs-^'s[k<ϠML֠*]7RSv ҷ={~8f3(Mu$!SiNB%-eCm?(=E-ÌUnh.܃չWJPh< .T:Ef݄!4cbNG#Ы$}aYߺr/5:ѹo\k^bViuUɽ>EotnGm5MAg\MvEXlS= Vz/b>N1Gm2 Ne-b|RjE`%?AR]:ĈbKn(WwL4kD݊ nQqQOkV$,iEdzAdP!/hupnT $]DC:'Đ`D9N&џ3旘aO!1,{`UȐ))~e{5A2AJYNf0xF,vm>O $-/:Q^7iqzO͋[y3 ɖg`e$ΕK=pvls.7<ͭ Cg( qΕ,IgŅ9* `>Hy>@'4њAhȅn@C : 6FnTʿ('8u)WD8SV:,U6=5^%q #; u=G4]'UQ~JH[C7_j:g8||+ۈp(MƸ:{5!{" oE^ /Kk{$W{^Z 8egR+ϼūi?S<]FPW0ᖻvWF2]ۄiWuT oj ~e"Z]wI^VZa hj/3ڏ+m33M䱺Jw aRc.#5)zGYG@8A[޾ G&ɤJRHX,D | vc.&k]]s }U{td/Zg`94uڌ# 7[8zz^Pϫg>CQ^T E, -F5=cLӴ 3ê}y̫|? Yzn>P]!>ppWLMlFKdAijRKjJMbU;`9yE za7Z٨!@ pK#E5$lzQ]BVUOxخջrl IXW@d_mc~# '2ne-NS,lF VPVkz$~I[ح9YS$)ޗ^c.*Z~"* uIWY*I^xP WbhH0Aue6ҋ)XhMwnAI8}XMVJs֋a~?jK:RGyՄzi߮/t@S짊Ѹ.AKcVFJNN*le1U2ƍLq 4uؗ~upy *=Nrp~Ѵb>b7CzJGܧ;HʝnB;M,}9`ET;eAbIh\^ }+kZ񼎖 ePQ1˛xt# yAi N}54zl iG+em&ƺKũ:DCShg.vU M&NN)`XCa>.?7XE눊΋&N7{UoUPhjPz֍z(աCY-Q)o_uchiqqACDl`R;pAaiDZ(6f;E#Ew%'(ٻX&Ey\;~&ҬZ ;I8 j]OBD~>t5Ӑ&$/˚\Qui?\і1ޗIjY2u\yH9C$ eCR`X`}c-cIzxb8oek m%#$?V0+p~SDc-)H ~ 6E2Q ]L:)TQlf@/6'"g?jHe)hRs``řJ{/^ls2jn=f*@w_yu*(_U)U paQ/9SI>AiV6"5m`V ʐt䟏H(LIu8dgEC&Hf`J mZ6WaMVҊEw{01u3Un&|%IAi/6܍ j:6_}$f7Hjzy[ 12FD5X?hX8 j(1t­Rq04{; ,3 *>g?gy;m˲l+OY^(+5 zc[~Êzׯ$Ar4 à n? 9?þ5Åi#kq+˄8̈I ͤbNvkZ֖FU1i7YcŸ" VcP*h̊׊A x7ty_z~;k3fԺS+b~Mͺ9du4Ձ;4abVJ;ksf~Vh7+ɺ$4\1+3LrF-m^3;/U {*(rd RɎ6ch^(4k}YdW3n*L ƓE@4D(h,M$08]hˋ<k6K\&?>^f8 8ne\J~q@LJ+)*GW1Rk~|ȃq:!7X8G{0pVaBpFc6F0Z5 ASۊ;@`쇏? F޲wq Ja ՓHcpぅ`Yx ZsBx3c)9*ɲa{p(QxlH`U'~RNا2ߥĠ^gP=* )?~<b$<#.oz_9tK&;.anuq56x_[R27}C|u_ICW|~&o/\ cawQ :++-Z'NF`14tt6SS$ z8vɌ%.F8䦂Cw/ƅ kІZKnԐzY>6P{wjR\зUR.:[cB"Ak)0>2! ȕ.5H`w#Zn*yTk*X+<&nG0(Leǯw&W~eCN̓=~ \ߋ}";zp`Kp^A VuFUÅa]zFpʹŎC_0ASh BcG4q 7p.`areh6T亹u>6GM4pf~ 9dVU r-}T\1>B\sX HFTf8*xrG̠"liZ)9qJu4y{ho %iD˲MqgO+8Y!>$kt0 5G Kb*.× "KDXum,WwMfݍz"L F+_ř9N-wU(j# Gk$?^L83@5 -4蚨>`\#^|X"o;n9F-sQDcSp!3c<8x1"=~?Ng(c(xM%GX ^ӘmA&<>/-JUAZ,,teʃHlG Rw)N&OEXC]*z}>unt6$[yV,r륉 6} <I+0yqUwT ! N|XBM$DpߏlՁz0np*9R.h[+׏r%С"@1Y4sإ`gru%LI< qJ+뜺c_;S'O<Ts0]6n;O)B!Fs=osD-bu'$Z ϻw׽< kgf?_p >A^ KMZSm0}Z_`=loNQ0 G <~w n8q6'3aYa0+xF^SwK4L`K{{:f I7 Ǭ8UJgRt\4K +ޖdyyOA[z2~ĉ*g9] A;c~!i`mܤ[I -dͶ}2t%i߶ʼny2TbQ?h5Bp?!~ xz#+rbCB#UpGg4=Uūcw,u)9SbmѾLP-)w[BdAgHpRe=aut)笠Z \J뷁J -ɦǪd+$Dh$ %~_h׉ U9jz1}1dh5t..Hžzn%@yv)nr\e$g<;] ɤ` (%c$}&htzSQcgY<3Ŋt; ; :KNwZp2oe@Hy_R箤"dG7jM+ o}u#;K'C<6}|&&/be5 >7h{t+\앦t2 k }?Xq /EQ̀cWk37$vɇ@ yHNcw3VaUg0=P/:umK\R$Hu=>O{T'Fc$zL!2gخS`KncINGPMs?gvgIϐ0Lg~H\ݤGM1zpS>{گ+}i *6zΗ UiTE)`\UmQ_*\蹘>h\nɏlcSq 9vv$G{p KGL&lGڸnS9: Նpmu&+&7F %}:) :Y5&S2ONUdh>mԕ5Zt%讛tG JX=:`&X! av&8茫mts$[;H0 5o( e84<$3&ɞ/wϜAl/rIBKэJ "5S$ꒆa @MB%BTEQ6MCasL;LS'fyrg#AvIOy=4Zk-UI 6ogo* wnCN v~u9w]͊V^QzjLEODNDz$,ΦkH.L"w,Nb8P|gs'rꑬh,aR27=TCui+@gܩ~,lo86Nf/bP;>d |Vl؀ )GN/ t2)*+=PEDU̜C06-sax_ &*uBTܹl=WUϻPĊA|b=p{1{o5* )Z6ݶލ N$| 3 |z a[Fyq7h׸lNG6jaZh ܠae.fFEU골yi8I-̟d-%DbD4vrymWm.Qs#gK)C3Q􋶰3K cJcqq*H](3zqpZ<H}GEOw$ UNIs%?:1|Jo\ТFW6Yr|hTɡS$.ثK<.HBIi-b1 ziֲNoRd0H/L'$U#sOLB+'j~9.ɯ4ctXm^L8 ѡN#+ ]u9d/VF;4ĹR 2i&$9q.ćn&2-<j~EXSѣԼk ~#-/@RWlbE~Q [q'ӟ3 2ed6ʕcxmk7AOTGI#q!dz&7OLب.j\-$%:i%яyP +{>RSDJ@K!#4V\ * SK;j,σ…jFҸ|#"IH8jH*ý:_O7$L $b+bWT&ɔaHx@.YC4FcBV-2HO@ChPl>"HgJ[QY@#ѻ!۩,4zVA1 V[VB_)$2(˒pʼ)~6qsM_)I" ITJX-;X0|9s2To Sq؁ I׍}aXUW٩)D`GQciclfWJU%g*:k 2~Ec80`vDOa@&/0@|{wgZdo߈mڇ!lgz:ƾDr]PVXAќrqvT[cMI(Lb"GRW3Y"a)[D}tqT(>~}K+X2^W'882vO\Ί*|>V4HrpQoޒXrX `zWuBG}lٞ}vfy,]-^36]ln\qs΋ϝ7;o>w~'>7>sjt莛]6}t ^~q~~~~'6wnֶ]s8 bu'Qʮ5z}U"5" :NRe' X]czy69 섦g${{`#k7eU;UTV*~,$xt@@R: SqpKqY9D,brd[rԢ׬]s[/PB)6!, \vp_9[/E/K%5sˇ %djrOcuo$5E7>C;9!8*?hE{%i ;=b({0#`HE<-5f]9GABMNƹ0'Yi"幚HSO)LV)E`k+_(?CpBpBp7~7~Ņoq㷸[|o[ OەFoFoFo"^|z#,=]n.gٍOn5؞vw͖\%Tf/ J _ +caNF_!W| E[~zлnviheo7HR"<1v 5g@$?pmQ8#)T]cfHi-åLʿdT,9XjP#ʓlG"!ytѩ:nT!RgYnb(rP"_&T3˦IcW{DǩP`d U &6~42u'u^k;B]:˩&i)w(K`~pae0gabpt_}E^ vK%{[%nd d %&n`:*Nqg5V M1Uo1m.H *s[ td]W. euʜ,&"8f5yr-9zb('Zc(Vb!NSV=q (OnRZ0DD+d@ )gum3]EXoCD1r W !E%k҈+(o))jN v3qj^]M2iFemV/gg5fNE$e2T8yƝG]"@jތ"7`e)xC 3n%*UޢQɾAmS;>Y$ Vх =fU$d>3e™D+|^??ΐn^og94B2,A#kPmlCV6_A;:Z? @ Q *h],ðlIŎR؏>lNeOyBrC<آ1^,?SXٲJ<w; 0g=z:1N)K^&\ۍa0P0P?Iڿ ^4? %q>O5S{8OL-=e'4AY^e_TE;]8Wd=Nն$J#~MQF =[~-ڢ6;-B:Ac]/uvT;W;<)hl]ڰ"_L0&xlZ8c]AHӶ(Kpo`|&Gj#;w "-D&`CѫDzE+ywPɮuQ$. , &pLոW,8iP}~˃h52#"`rbl( Dò{&Ix;/flj矄_W'>o#޿_#>~F/q/NsUxLF9QJisw:V=c~nC[u_}`H\5'Ń3|x 0ްGѣ)X"N1`Y2E91g1%ChiauaFi67$1(& _UjR5Ou6g70'Uc RORLmib%oYd1M&YM*-Pxp4nsnbruܮNfw][~nV[ dޟeiyӔ<IF״)Nҹ6"0Kn^z.3c;<IqY2?Ii9Ʋ9O ΐInvL=e]guWv[Y J4HNӫ,ɈkM*FsKKL莱Wȃf+>fdzTclG*P4ث)ܼT]z0.ps$mp=F}g-UU!uQ{ɤ2Ei,6n9;8pul"I=r>!ڟRfi /?3}kir$kyӰǼh~M1nѳTkM jyFz<9_=#1xgv_xDǏ _e~_~r?OtB8_ g?~w؝ _ DRi d $UHV7M#[4UvjLE{E-#"Da2j}8ݱٽ$ KTV#CK[l^`!bA~0U`LJFeͯuĖf&ڌ8"oe,ӷ*d]zlnCQuru@%w]/4Ǥ*qRqF+2tTݵo/Q(V\@G j ,U8^ >z)٧A_7<2dol#|?XOTj@A!Uz5k_K:Pk_j3'ݮΆ5'ӂLǤ&z8TLtt^JAX<%.aH *} 4&S 5J G7uOк/5chT>u\j-(DwZ4&z3 ̓,57o }apԸp"cO=H.R.ٺ0+?|J%(5j> ĎT2P&ۏ蚰bبs~5s:2O6j^H;B5>j{|lnU} )d²R4\%UCz!-m+'(O*܍(E/XS@&F"jjc݊ xCѝV"5i0sN-3?+vqwc F7>0 3|KDaWU[Ɍ55k< mH@~bq~U(1C=Le^n"tgPN4E[zhCMgxjAJF= Fw#1pqVA:AYNF*9-֒WT+k5%EExnG=AÉXl\sh 齀{Ѽ"k)ym؛/l ߋgE߳M k:ߑƈG7`~s>lO>!^nu8{t!F ޅzH*(xjntl>O1,XnIdUTX3am" P[g V]S-WA @s|i-iUCNUWYh$2p L;5Umn= m9DНWFԼ{zw3avt 5(SqlH7 o4|@I2~dLƐRT$['/cmK!=,DH?Dܗ; xHKkd k։13>|.,@5)q@h(hӤUReS5MGD}yZTRֽwd̕1jXPd#zJ>O&?u3 ܦW5vٝ)ݝ bW(n9ߎ^ /P7J#80bG) (u)VB{,:_-$UpﯸKm*ߙ+A͂  !F\4'ɪ 3n<ı./Gx? q,6F jeBq")gy.o Ljn,4wJʪwfyl,V,67Y2I{6=1M }‹C#|a6$Ac=W嫣)i.fkD]Ho+fCtUHd[LtЖ J-{= &uI)ө⩏JARAkxN\M <_)_U`Zl(%э&1NM* όo lbY ߳zIȍT-hS ZW5.ůʗhȠ<АУ8aH093I#tӑg7q2jB6+e,# >丆T'b7rD-\VQfCSbብ G%S;Xax1J$be>b'*e=aiKImP aGk"Cv6-s\r5}iɅ Ճ%MdaG݁D!rY.`|TRXf̈7mj"VHaʈ)sۛTrଞ=JC-P?n]p I\sqAZN_7kL˖񅘍7BTeL^P@-&߿I_% F{W3j2-ڠ1^e r; Jhhyq*No8t gg7텄q/ww+dU߆ &Rəp 6RܘCRX-aKBbzZ0w0ęB,qg%ǡ[ 498څ6z2}#٤4>[rf7 AGĐm3&-ZvڧUF3^ڬl{j6k`+_H}G:nbGHs&VJeA@SW*qTObh?Ɖ@k]e7V^=FF=\]H'eX LgeiJfT 4 +Fl L_rfT!@Edh_Ӝ -.[(=2Z@LAV%BaguʴtfxS qCo%"uiBD̺12K    AV"ˆX(.Ν}fʇji#au#(C&%PILc甑v p)آ F"œAapL G[Wv 2"0ƻX~:dݪ]uhK g70m@1+Tկo_`{w85ɼ9/hA'̯?]Iq:]}|#o%Vpw?|Yti9cO.yĕ|Y"30힫5{tx^(˱7b+ .grt7)'/l&Q6Yi$z:]]xZrD~Ӏɾ2~#+-HM7L^lz,pu 7v9c c |M bF/cWVt#~fdrOn='~d\qk1kr0 '_CDl3L~p.wK@a]S~? 3ܟ<]g Tv}9HQ8xTgm.Mq!#j4)9f&/-d>*pG?~{8QiZƸM/;nQg^1"y <)oڱ%Uaxf$=?8uIAHWKk@+^ Zn- 6{J.BUj\V]{ƹ PX[RPqaQZ"גʲfٗZ3I+qǠPTNjO$Ϋ'O UD20χKξqCEj.bZUیT$:˵#1?^؆*6ɱAR[v3Gf5 ܕ&<'106H&OT}Z$N.aD'Fva@ y :DUUz-d#+ٜ@q65h ǥĄM3~]/n֐սʵ*ߪ)_5/GeM q~r endstream endobj 9 0 obj <> endobj 10 0 obj <> endobj 11 0 obj <> endobj 12 0 obj <> endobj 16 0 obj <> endobj 17 0 obj <>stream HDL[U﫼*Gx 7=!Mps8 )-m lebd٨cA]͘6eYs9|r$D845hvn|Gjm+ca!Zd@^' 1eac4ZtڝKLW.^uh+ʴƞP[ OOE*5:QijB̴R!iJ}*vV:K;g2p >~'!]'/iũys(V,-"t>a6 p0_cZXF:F!xTJ8ObaxɭDŨ7q`U330TlBgQzGY:$7s}V˳mklVfY/]Ր7߸΅yHMxޟEe> endobj 18 0 obj <>stream HD T^D^1|j*m| Um*bbb5@kmRW[֪YW}E\jfYg=g퐜A1"'ý+)1fZz[2"t~eWaFIٳU-IA߭]*BEv$F1#2?Z r8zTVY=z-6gδy%όJ/_(}F܌!c^$2 gΒ$IR{,KRCJvHi]2Ti"XFIeWIGt]l e iRLZ)m8-AA'x]s79"g"gۊUn^MB3TȵP%t\гafXE+wE)>բ>7KE7|uJOkRp\ӰvkʑMo}4[TCY&~M/Yii(y59GDlmV[2+&C!occ_Z`]!)2j}ev2c:a ؕ<O- Qoͷ*Y|`4VHC.rble<bq\p¨)XfԪ5C(V.,M,VN egF 3 ~B7bDE\tns/lÞL MvE(՘}QmCrG$&u $Z\n5rU{zLb=S&"|NeL`XE-*Ҍ7dfPH ɸ~hx9x]bo#<$+oJ݊Blޱ~JʹƏ39ǐvf6Aaѽ9.oD7LH ^migk,јᜧz ːܐmم% N[hǏʢl_ygqIѠ#;:X&=/W11Ojێ[V6H~:|X0[.|"Pv`xF.^/a/ӞhOzJ5x ԙf#f~D ;LV1Mnm nYj%0ZgXi7?J[rk-Fvy 8f=b}(>X-zI>}X,T-t }+-ۢyj %OZ*")ǿJz^:쳓t{*6pnbYY4,DY!La3~8\~ q ,c)cD>h3ZOd[z1=N%)lFNct< =6U|vde.8~Ed 3=m\0u0XggǏ9FTbw.FxҀDƚ *(?A\LC4R&Fr'hNzѵHeC5\ԾQuk 3, PdWbdP%ZeT!]Zz{N'*v䞿e0p„d 0.)v"#H|~N˽N5 ״͆2U W c&)s1xbE%-Iнt «OJu,lߠ)w-l#MB"DjF"]>lPۏԮ< lV|2sTz8#̛Y/ʣ]I*XA_I[ 7128<|1bJVTJ2,Z5Wh'r>xG3|mhj:Q+TĀ*ۍ8ΰôbo8%, '',{䖫`keb5ԱNG5`oLfˌyw+t-ժ4_)^E\gN}p∄5GB._Л޷qIwnzn/D,w"V9wwCF}wMBS,ȾI/Bd&j]&gksILM¢a.Cg MLKWNVٔLƟ?vڵ|cfjJ0&ly쿜uRikABR#ڗgH>`y2/Pȼv6# NUwӦۄ5'S#o)«kqgفvPD}*)WgM}h}owME3 endstream endobj 14 0 obj <> endobj 19 0 obj <>stream HT{P{3Dtu q:CV_AA{AAY*tG3©Xxq _q58Bږlh4{l3HUG4>`:+2a!Jȹ#qvA)5:4;xwP2LGM++zdrAP*D3s r q(z^6|2nE mrӌfH5ֱsufwpt)(}o&3T. Wf{WE<ϋ| [L՘Ϥu<\pQr(0a:}c!F!}6aƐtz :fGPh3OOd C<,?Ql6A Ҭ)D՗ ?WB([R}׻ۘ DKWq7K|/w'cSGD?eD3̀[6&#mK|ҨjB.\]nv%v(v;g`έNtlB GLm1kP)!ˉ YgN2-Uzg[l4⑇/8L!LIjȅ-TN2~4i8iHL3Tjԙ'ڷPd}.lJ`6L"AQ9BN=cI7qE֪SBX:]Ŭ`2҉wkX+mW s)JGVG~+Q"GG],Wc|~U܃7n[270Yax`2TMx/A+ kIQ "/Mb(#'0:![]Lz[%aEn7G9,pD+n#x7l9<'c38'5i~p<=p5RZ\eg90칉ѫ_Kg'͙-Ϡ,o(~CQOKG>NDvI`S0ZPمw: endstream endobj 13 0 obj <> endobj 20 0 obj <>stream HklwcJDlIg64I4MH@(6 !cƎo{߳3sgvfazq ƅ` 4U+Iˣ JiԦU/Y:T+ܣ=ӱ\Î@oGv{CݭT8g=i&u+͝==z Gӹ~o}o,qxڶ{oo3kh<{8^݀/v=<!>NzGc㇎ݎ}oGm;?:G\UU[n*ͤq >\B%(5XC*T*@^x ک^ӫf۪r9br"Z5/k`BI8"2Vڳl5oÂ6w\u*cOas 6Lr3)ոce)#^M1InjVl֍$)7vwezs͠E& -h4% nݞHBmA  YI 1hrKTU!iNV30S_?T0] S~,}j@tHY>UcsK|^"d{#2%hJ:+XQTq\+Lj#0!,= V3IYT}(@3)" !X:D$.5B Kaxlþdm'j(2(ҔMQgb= Rқ)6lp\f KiJ} kG3~pkO1\on̼8\S=);CDt IVYYcA։F_ΣlƧ4H-r'0abW'I",ހgɡ3I}\WL*B3_̇K֓"aE]{S먱 ׌ =DRZ42eFWU<`KN endstream endobj 8 0 obj <> endobj 5 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry